Cart 18 Product Products 2 580,51 € (empty)
-
-
1 x TGFB1-tran...121,50 € -
-
1 x TRAF4...259,07 € -
-
1 x MRPL36-mit...113,40 € -
-
1 x COX7A2L-cy...113,40 € -
1 x FAM83F-fam...121,50 € -
1 x PTDSS2-pho...121,50 € -
1 x STH-saitoh...113,40 € -
1 x OMG-oligod...121,50 € -
1 x Ret...259,07 € -
1 x C2orf53-ch...121,50 € -
1 x CD320-CD32...121,50 € -
-
1 x C15orf23-c...121,50 € -
1 x ATP1B1-ATP...121,50 €
No products
To be determined Shipping
2 580,51 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 18 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 580,51 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 580,51 €
Data sheet of MGC10981-hypothetical protein MGC10981 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MGC10981-hypothetical protein MGC10981 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004397 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MGC10981 |
| Origin species: | Human |
| Product name: | MGC10981-hypothetical protein MGC10981 Gene |
| Size: | 2ug |
| Accessions: | BC004397 |
| Gene id: | 84740 |
| Gene description: | hypothetical protein MGC10981 |
| Synonyms: | AFAP1-AS; AFAP1AS; AFAP1 antisense RNA 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccaaggacactgccagcctcttcattcccctgtgtggatgctccaactccaaaagtggaaccacagggcaaatgaatgtcggcacgtgtcggtatggcagcctcgctcttcgacagctggtgtgggggttaccacctggggctagctggcctcatcttcgttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - POM121 membrane glycoprotein C - serine PI Kazal type 5-like 3 - hypothetical protein FLJ25404 - adenine phosphoribosyltransferase |