PTXBC027476
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC027476 |
Product type: | DNA & cDNA |
Ncbi symbol: | CNOT6 |
Origin species: | Human |
Product name: | CNOT6-CCR4-NOT transcription complex, subunit 6 Gene |
Size: | 2ug |
Accessions: | BC027476 |
Gene id: | 57472 |
Gene description: | CCR4-NOT transcription complex, subunit 6 |
Synonyms: | CCR4; Ccr4a; CCR4-NOT transcription complex subunit 6; carbon catabolite repression 4 protein; carbon catabolite repressor protein 4 homolog; cytoplasmic deadenylase |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgtgcatcatgacaatttccagtgaaggtgagctggagctggttggactaatgagactgaggaagcagcttttcctacgatctgcattatgtaatcacaggtccagagagctttatggaagcgggagaggaggagcacttactcatgttgtatttgttaatggaggatgtcatcttttcatagatgctggaactagagtgcacttgttagatgctaaaggtttgagctttacacaaaatgtcttcatctgtatttgttattgtctacaatatatttga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - serine peptidase inhibitor, Kazal type 6 - serine peptidase inhibitor, Kazal type 4 - F-box and leucine-rich repeat protein 21 - F-box and leucine-rich repeat protein 15 |