> >>GOLT1B-golgi transport 1 homolog B (S. cerevisiae) Gene
GOLT1B-golgi transport 1 homolog B (S. cerevisiae) Gene View larger

GOLT1B-golgi transport 1 homolog B (S. cerevisiae) Gene

PTXBC012455

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of GOLT1B-golgi transport 1 homolog B (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GOLT1B-golgi transport 1 homolog B (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012455
Product type: DNA & cDNA
Ncbi symbol: GOLT1B
Origin species: Human
Product name: GOLT1B-golgi transport 1 homolog B (S. cerevisiae) Gene
Size: 2ug
Accessions: BC012455
Gene id: 51026
Gene description: golgi transport 1 homolog B (S. cerevisiae)
Synonyms: CGI-141; GCT2; GOT1; GOT1B; YMR292W; vesicle transport protein GOT1B; germ cell tumor 2; hGOT1a; golgi transport 1B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatctccttaacggacacgcagaaaattggaatgggattaacaggatttggagtgtttttcctgttctttggaatgattctcttttttgacaaagcactactggctattggaaatgttttatttgtagccggcttggcttttgtaattggtttagaaagaacattcagattcttcttccaaaaacataaaatgaaagctacaggtttttttctgggtggtgtatttgtagtccttattggttggcctttgataggcatgatcttcgaaatttatggattttttctcttgttcaggggcttctttcctgtcgttgttggctttattagaagagtgccagtccttggatccctcctaaatttacctggaattagatcatttgtagataaagttggagaaagcaacaatatggtataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fibroblast growth factor receptor substrate 3
- BH3-like motif containing, cell death inducer
- similar to ubiquitin specific protease 6
- limb bud and heart development homolog (mouse)

Reviews

Buy GOLT1B-golgi transport 1 homolog B (S. cerevisiae) Gene now

Add to cart