No products
Prices are tax excluded
PTXBC012455
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC012455 |
Product type: | DNA & cDNA |
Ncbi symbol: | GOLT1B |
Origin species: | Human |
Product name: | GOLT1B-golgi transport 1 homolog B (S. cerevisiae) Gene |
Size: | 2ug |
Accessions: | BC012455 |
Gene id: | 51026 |
Gene description: | golgi transport 1 homolog B (S. cerevisiae) |
Synonyms: | CGI-141; GCT2; GOT1; GOT1B; YMR292W; vesicle transport protein GOT1B; germ cell tumor 2; hGOT1a; golgi transport 1B |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgatctccttaacggacacgcagaaaattggaatgggattaacaggatttggagtgtttttcctgttctttggaatgattctcttttttgacaaagcactactggctattggaaatgttttatttgtagccggcttggcttttgtaattggtttagaaagaacattcagattcttcttccaaaaacataaaatgaaagctacaggtttttttctgggtggtgtatttgtagtccttattggttggcctttgataggcatgatcttcgaaatttatggattttttctcttgttcaggggcttctttcctgtcgttgttggctttattagaagagtgccagtccttggatccctcctaaatttacctggaattagatcatttgtagataaagttggagaaagcaacaatatggtataa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - fibroblast growth factor receptor substrate 3 - BH3-like motif containing, cell death inducer - similar to ubiquitin specific protease 6 - limb bud and heart development homolog (mouse) |