PTXBC028404
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC028404 |
Product type: | DNA & cDNA |
Ncbi symbol: | VSTM2A |
Origin species: | Human |
Product name: | VSTM2A-V-set and transmembrane domain containing 2A Gene |
Size: | 2ug |
Accessions: | BC028404 |
Gene id: | 222008 |
Gene description: | V-set and transmembrane domain containing 2A |
Synonyms: | VSTM2; V-set and transmembrane domain-containing protein 2A; V-set and transmembrane domain containing 2; V-set and transmembrane domain containing 2A |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggggatctttttggtgtatgttggatttgttttcttttccgttttatatgtacaacaagggctttcttctcaagcaaaatttaccgagtttccgcggaacgtgacggcgaccgaggggcagaatgtggagatgtcctgcgccttccagagcggctccgcctcggtgtatctggagatccaatggtggttcctgcgggggccggaggacctggatcccggggccgagggggccggcgcgcaggtgaagctcttgcccgacagagacccggacagcgacgggaccaagatcagcacagtgaaagtccaaggcaatgacatctcccacaagcttcagatttccaaagtgaggaaaaaggatgaaggcttatatgagtgcagggtgactgatgccaactacggggagcttcaggaacacaaggcccaagcctatctgaaagtcaatgcaaacagccatgcccgcagaatgcaggccttcgaagcctcgcccatgtggctgcaggatatgaagccccgcaagaacgtctccgcagccatccccagcagcatccatggctctgccaaccaacgaacgcactccacctccagccctcaagtggtagccaaaatccccaaacaaagtccacaatcaggtatggaaacccatttcgagccttttattttaccactcacaaacgctccacagaaaggtcagtcgtatagagtagacagatttatgaatggtgatttttaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - minichromosome maintenance complex component 8 - musculoskeletal, embryonic nuclear protein 1 - glutathione S-transferase theta pseudogene 1 - small nuclear ribonucleoprotein polypeptide F |