MXI1-MAX interactor 1 Gene View larger

MXI1-MAX interactor 1 Gene

PTXBC035128

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MXI1-MAX interactor 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MXI1-MAX interactor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035128
Product type: DNA & cDNA
Ncbi symbol: MXI1
Origin species: Human
Product name: MXI1-MAX interactor 1 Gene
Size: 2ug
Accessions: BC035128
Gene id: 4601
Gene description: MAX interactor 1
Synonyms: MAD2; MXD2; MXI; bHLHc11; max-interacting protein 1; MAX dimerization protein 2; Max-related transcription factor; class C basic helix-loop-helix protein 11; MAX interactor 1, dimerization protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaagcacatcaacacttttctgcagaacgtgcagattctgctcgaggccgccagctacctggagcagatcgagaaagaaaacaaaaagtgtgaacatggctacgcctcttcattcccgtccatgccgagcccccgactgcagcattcaaagcccccacggaggttgagccgggcacagaaacacagcagcgggagcagcaacaccagcactgccaacagatctacacacaatgagctggaaaagaatcgacgagctcatctgcgcctttgtttagaacgcttaaaagttctgattccactaggaccagactgcacccggcacacaacacttggtttgctcaacaaagccaaagcacacatcaagaaacttgaagaagctgaaagaaaaagccagcaccagctcgagaatttggaacgagaacagagatttttaaagtggcgactggaacagctgcagggtcctcaggagatggaacgaatacgaatggacagcattggatcaactatttcttcagatcgttctgattcagagcgagaggagattgaagtggatgttgaaagcacagagttctcccatggagaagtggacaatataagtaccaccagcatcagtgacattgatgaccacagcagcctgccgagtattgggagtgacgagggttactccagtgccagtgtcaaactttcattcacttcatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TP53 target 3
- neuritin 1-like
- peroxiredoxin 5
- proline rich 10

Reviews

Buy MXI1-MAX interactor 1 Gene now

Add to cart