Cart 7 Product Products 804,71 € (empty)
-
-
1 x IL28A-inte...113,40 € -
-
1 x ORC6L-orig...113,40 € -
1 x ARMCX3-arm...121,50 € -
1 x RRP15-ribo...113,40 € -
1 x RBMS3-RNA...121,50 €
No products
To be determined Shipping
804,71 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 804,71 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 804,71 €
View larger 
Data sheet of LOC389833-similar to hypothetical protein MGC27019 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LOC389833-similar to hypothetical protein MGC27019 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008921 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LOC389833 |
| Origin species: | Human |
| Product name: | LOC389833-similar to hypothetical protein MGC27019 Gene |
| Size: | 2ug |
| Accessions: | BC008921 |
| Gene id: | 389833 |
| Gene description: | similar to hypothetical protein MGC27019 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctctgccctagagccgctttcctggtaggatcctttcatggcgtcttcccaggacctcctgccagctcccattgggagttttgggtcccctccaccccagtaggtgcatacttctgccctccccagccccagctcacaccccccaacacccccaagctggtgagtgaggtggaggagctgtacaagtccatcacagcgctgcgggagaagcttctacaagcggagcagtccctgcgcaacctcaaggacatccacatgagcctggagaaggacgtcactgccatgaccaacagtctcttcatcgaccgccagaagtgcatggcccatcgtacttgctaccccaccattctgcagctggctggctaccagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - golgi transport 1 homolog B (S. cerevisiae) - fibroblast growth factor receptor substrate 3 - BH3-like motif containing, cell death inducer - similar to ubiquitin specific protease 6 |