No products
Prices are tax excluded
PTXBC008921
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC008921 |
Product type: | DNA & cDNA |
Ncbi symbol: | LOC389833 |
Origin species: | Human |
Product name: | LOC389833-similar to hypothetical protein MGC27019 Gene |
Size: | 2ug |
Accessions: | BC008921 |
Gene id: | 389833 |
Gene description: | similar to hypothetical protein MGC27019 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgctctgccctagagccgctttcctggtaggatcctttcatggcgtcttcccaggacctcctgccagctcccattgggagttttgggtcccctccaccccagtaggtgcatacttctgccctccccagccccagctcacaccccccaacacccccaagctggtgagtgaggtggaggagctgtacaagtccatcacagcgctgcgggagaagcttctacaagcggagcagtccctgcgcaacctcaaggacatccacatgagcctggagaaggacgtcactgccatgaccaacagtctcttcatcgaccgccagaagtgcatggcccatcgtacttgctaccccaccattctgcagctggctggctaccagtga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - golgi transport 1 homolog B (S. cerevisiae) - fibroblast growth factor receptor substrate 3 - BH3-like motif containing, cell death inducer - similar to ubiquitin specific protease 6 |