PTXBC010455
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC010455 |
Product type: | DNA & cDNA |
Ncbi symbol: | DDX39 |
Origin species: | Human |
Product name: | DDX39-DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene |
Size: | 2ug |
Accessions: | BC010455 |
Gene id: | 10212 |
Gene description: | DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 |
Synonyms: | DDX39; BAT1; BAT1L; DDXL; URH49; ATP-dependent RNA helicase DDX39A; DEAD (Asp-Glu-Ala-Asp) box polypeptide 39; DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A; DEAD box protein 39; DEAD-box helicase 39A; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 39; UAP56-related helicase, 49 kDa; nuclear RNA helicase URH49; nuclear RNA helicase, DECD variant of DEAD box family; DExD-box helicase 39A |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcagaacaggatgtggaaaacgatcttttggattacgatgaagaggaagagccccaggctcctcaagagagcacaccagctccccctaagaaagacatcaagggatcctacgtttccatccacagctctggcttccgggactttctgctgaagccggagctcctgcgggccatcgtggactgtggctttgagcatccttctgaggtccagcatgagtgcattccccaggccatcctgggcatggacgtcctgtgccaggccaagtccgggatgggcaagacagcggtcttcgtgctggccaccctacagcagattgagcctgtcaacggacaggtgacggtcctggtcatgtgccacacgagggagctggccttccagatcagcaaggaatatgagcgcttttccaagtacatgcccagcgtcaaggtgtctgtgttcttcggtggtctctccatcaagaaggatgaagaagtgttgaagaagaactgtccccatgtcgtggtggggaccccgggccgcatcctggcgctcgtgcggaataggagcttcagcctaaagaatgtgaagcactttgtgctggacgagtgtgacaagatgctggagcagctggacatgcggcgggatgtgcaggagatcttccgcctgacaccacacgagaagcagtgcatgatgttcagcgccaccctgagcaaggacatccggcctgtgtgcaggaagttcatgcaggatgtgagtagggcgagagtggcagctttggccttccccaggggcctggagcctggggccccaggacacccgcacggcccacatggcacggaggatgctgggatgctgggagccggcggagcctcctttcctcccctcggtcttgtcaaactgggagtcaagcttggtccacacctgagtcgggccagagcttacatccagcttttgagcgatgtttactga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - CCR4-NOT transcription complex, subunit 6 - serine peptidase inhibitor, Kazal type 6 - serine peptidase inhibitor, Kazal type 4 - F-box and leucine-rich repeat protein 21 |