Cart 9 Product Products 1 021,13 € (empty)
-
1 x SORD-sorbi...121,50 € -
-
-
1 x GTPBP3-GTP...121,50 € -
1 x SRD5A3-ste...121,50 € -
-
1 x LACTB2-lac...121,50 € -
-
1 x CAMK4-calc...121,50 €
No products
To be determined Shipping
1 021,13 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 021,13 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 021,13 €
View larger 
Data sheet of CHGA-chromogranin A (parathyroid secretory protein 1) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CHGA-chromogranin A (parathyroid secretory protein 1) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001059 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CHGA |
| Origin species: | Human |
| Product name: | CHGA-chromogranin A (parathyroid secretory protein 1) Gene |
| Size: | 2ug |
| Accessions: | BC001059 |
| Gene id: | 1113 |
| Gene description: | chromogranin A (parathyroid secretory protein 1) |
| Synonyms: | CGA; chromogranin-A; SP-I; betagranin (N-terminal fragment of chromogranin A); catestatin; chromofungin; parathyroid secretory protein 1; pituitary secretory protein I |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgctccgccgctgtcctggctcttctgctctgcgccgggcaagtcactgcgctccctgtgaacagccctatgaataaaggggataccgaggtgatgaaatgcatcgttgaggtcatctccgacacactttccaagcccagccccatgcctgtcagccaggaatgttttgagacactccgaggagatgaacggatcctttccattctgagacatcagaatttactgaaggagctccaagacctcgctctccaaggcgccaaggagagggcacatcagcagaagaaacacagcggttttgaagatgaactctcagaggttcttgagaaccagagcagccaggccgagctgaaagaggcggtggaagagccatcatccaaggatgttatggagaaaagagaggattccaaggaggcagagaaaagtggtgaagccacagacggagccaggccccaggccctcccggagcccatgcaggagtccaaggctgaggggaacaatcaggcccctggggaggaagaggaggaggaggaggaggccaccaacacccaccctccagccagcctccccagccagaaatacccaggcccacaggccgagggggacagtgagggcctctctcagggtctggtggacagagagaagggcctgagtgcagagccagggtggcaggcaaagagagaagaggaggaggaggaggaggaggaggctgaggctggagaggaggctgtccccgaggaagaaggccccactgtagtgctgaacccccacccgagccttggctacaaggagatccggaaaggcgagagtcggtcggaggctctggctgtggatggagctgggaagcctggggctgaggaggctcaggaccccgaagggaagggagaacaggagcactcccagcagaaagaggaggaggaggagatggcagtggtcccgcaaggcctcttccggggtgggaagagcggagagctggagcaggaggaggagcggctctccaaggagtgggaggactccaaacgctggagcaagatggaccagctggccaaggagctgacggctgagaagcggctggaggggcaggaggaggaggaggacaaccgggacagttccatgaagctctccttccgggcccgggcctacggcttcaggggccctgggccgcagctgcgacgaggctggaggccatcctcccgggaggacagccttgaggcgggcctgcccctccaggtccgaggctaccccgaggagaagaaagaggaggagggcagcgcaaaccgcagaccagaggaccaggagctggagagcctgtcggccattgaggcagagctggagaaagtggcccaccagctgcaggcactacggcggggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transcription elongation factor A (SII)-like 1 - catenin (cadherin-associated protein), delta 1 - inhibitor of growth family, X-linked, pseudogene - phosphodiesterase 6G, cGMP-specific, rod, gamma |