VAMP8-vesicle-associated membrane protein 8 (endobrevin) Gene

View larger

VAMP8-vesicle-associated membrane protein 8 (endobrevin) Gene

Reference: PTXBC001634

Condition: New product

Print

Data sheet of VAMP8-vesicle-associated membrane protein 8 (endobrevin) Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about VAMP8-vesicle-associated membrane protein 8 (endobrevin) Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC001634
Product type:	DNA & cDNA
Ncbi symbol:	VAMP8
Origin species:	Human
Product name:	VAMP8-vesicle-associated membrane protein 8 (endobrevin) Gene
Size:	2ug
Accessions:	BC001634
Gene id:	8673
Gene description:	vesicle-associated membrane protein 8 (endobrevin)
Synonyms:	EDB; VAMP-8; vesicle-associated membrane protein 8; vesicle-associated membrane protein 8 (endobrevin); vesicle associated membrane protein 8
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atggaggaagccagtgaaggtggaggaaatgatcgtgtgcggaacctgcaaagtgaggtggagggagttaagaatattatgacccagaatgtggagcggatcctggcccggggggaaaacttggaacatctccgcaacaagacagaggatctggaagccacatctgagcacttcaagacgacatcgcagaaggtggctcggaaattctggtggaagaacgtgaagatgattgtccttatctgcgtgattgtttttatcatcatcctcttcattgtgctctttgccactggtgccttctcttaa
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- RanBP-type and C3HC4-type zinc finger containing 1 - SMEK homolog 1, suppressor of mek1 (Dictyostelium) - agouti signaling protein, nonagouti homolog (mouse) - proteolipid protein 2 (colonic epithelium-enriched)

Reviews

Be the first to write your review !

Buy VAMP8-vesicle-associated membrane protein 8 (endobrevin) Gene now