Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RYBP-RING1 and YY1 binding protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RYBP-RING1 and YY1 binding protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC036459 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RYBP |
| Origin species: | Human |
| Product name: | RYBP-RING1 and YY1 binding protein Gene |
| Size: | 2ug |
| Accessions: | BC036459 |
| Gene id: | 23429 |
| Gene description: | RING1 and YY1 binding protein |
| Synonyms: | ring1 interactor RYBP; AAP1; APAP-1; DEDAF; YEAF1; RING1 and YY1-binding protein; DED-associated factor; YY1 and E4TF1 associated factor 1; apoptin-associating protein 1; death effector domain-associated factor; RING1 and YY1 binding protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccatgggcgacaagaagagcccgaccaggccaaaaagacaagcgaaacctgccacagacgaagggttttgggattgtagcgtctgcaccttcagaaacagtgctgaagcctttaaatgcagcatctgcgatgtgaggaaaggcacctccaccagaaaacctcggatcaattctcagctggtggcacaacaagtggcacaacagtatgccaccccaccaccccctaaaaaggagaagaaggagaaagttgaaaagcaggacaaagagaaacctgagaaagacaaggaaattagtcctagtgttaccaagaaaaataccaacaagaaaaccaaaccaaagtctgacattctgaaagatcctcctagtgaagcaaacagcatacagtctgcaaatgctacaacaaagaccagcgaaacaaatcacacctcaaggccccggctgaaaaacgtggacaggagcactgcacagcagttggcagtaactgtgggcaacgtcaccgtcattatcacagactttaaggaaaagactcgctcctcatcgacatcctcatccacagtgacctccagtgcagggtcagaacagcagaaccagagcagctcggggtcagagagcacagacaagggctcctcccgttcctccacgccaaagggcgacatgtcagcagtcaatgatgaatctttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cartilage associated protein - replication protein A1, 70kDa - integrator complex subunit 7 - canopy 1 homolog (zebrafish) |