Cart 1 Product Products 121,50 € (empty)
-
1 x CCDC151-co...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
Data sheet of KCNIP2-Kv channel interacting protein 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNIP2-Kv channel interacting protein 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034685 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNIP2 |
| Origin species: | Human |
| Product name: | KCNIP2-Kv channel interacting protein 2 Gene |
| Size: | 2ug |
| Accessions: | BC034685 |
| Gene id: | 30819 |
| Gene description: | Kv channel interacting protein 2 |
| Synonyms: | KCHIP2; Kv channel-interacting protein 2; A-type potassium channel modulatory protein 2; Kv channel interacting protein 2; cardiac voltage-gated potassium channel modulatory subunit; potassium channel-interacting protein 2; potassium voltage-gated channel interacting protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcggggccagggccgcaaggagagtttgtccgattcccgagacctggacggctcctacgaccagctcacgggccaccctccagggcccactaaaaaagcgctgaagcagcgattcctcaagctgctgccgtgctgcgggccccaagccctgccctcagtcagtgaaaacagcgtggacgatgaatttgaattgtccaccgtgtgtcaccggcctgagggtctggagcagctgcaggagcaaaccaaattcacgcgcaaggagttgcaggtcctgtaccggggcttcaagaacgaatgtcccagcggaattgtcaatgaggagaacttcaagcagatttactcccagttctttcctcaaggagactccagcacctatgccacttttctcttcaatgcctttgacaccaaccatgatggctcggtcagttttgaggactttgtggctggtttgtccgtgattcttcggggaactgtagatgacaggcttaattgggccttcaacctgtatgaccttaacaaggacggctgcatcaccaaggaggaaatgcttgacatcatgaagtccatctatgacatgatgggcaagtacacgtaccctgcactccgggaggaggccccaagggaacacgtggagagcttcttccagaagatggacagaaacaaggatggtgtggtgaccattgaggaattcattgagtcttgtcaaaaggatgagaacatcatgaggtccatgcagctctttgacaatgtcatctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAB31, member RAS oncogene family - aldolase A, fructose-bisphosphate - glutathione S-transferase theta 2 - keratin associated protein 4-1 |