RGS17-regulator of G-protein signaling 17 Gene View larger

RGS17-regulator of G-protein signaling 17 Gene

PTXBC013117

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RGS17-regulator of G-protein signaling 17 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RGS17-regulator of G-protein signaling 17 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013117
Product type: DNA & cDNA
Ncbi symbol: RGS17
Origin species: Human
Product name: RGS17-regulator of G-protein signaling 17 Gene
Size: 2ug
Accessions: BC013117
Gene id: 26575
Gene description: regulator of G-protein signaling 17
Synonyms: RGS-17; RGSZ2; hRGS17; regulator of G-protein signaling 17
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgaaaaaggcagcagtcccaaaatgaaggaacacctgccgtgtctcaagctcctggaaaccagaggcccaacaacacctgttgcttttgttggtgctgttgttgcagctgctcctgcctcactgtgaggaatgaagaaagaggggaaaatgcgggaagacccacacacactacaaaaatggagagtatccaggtcctagaggaatgccaaaaccccactgcagaggaagtcttgtcctggtctcaaaattttgacaagatgatgaaggccccagcaggaagaaaccttttcagagagttcctccgaacagaatacagtgaagagaacctacttttctggcttgcttgtgaagacttaaagaaggagcagaacaaaaaagtaattgaagaaaaggctaggatgatatatgaagattacatttctatactatcaccaaaagaggtcagtcttgattctcgagttagagaggtgatcaatagaaatctgttggatcccaatcctcacatgtatgaagatgcccaacttcagatatatactttaatgcacagagattcttttccaaggtttttgaactctcaaatttataagtcatttgttgaaagtactgctggctcttcttctgaatcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 126
- oxysterol binding protein-like 10
- keratin associated protein 19-7
- keratin associated protein 19-1

Reviews

Buy RGS17-regulator of G-protein signaling 17 Gene now

Add to cart