Cart 21 Product Products 2 774,47 € (empty)
-
-
1 x EDNRB-endo...121,50 € -
-
1 x FAM43A-fam...121,50 € -
-
1 x CMTM2-CKLF...113,40 € -
1 x C8orf34-ch...121,50 € -
1 x C20orf112-...121,50 € -
1 x E2F2-E2F...113,40 € -
-
-
-
1 x SUMF1-sulf...121,50 € -
1 x COL8A2-col...121,50 € -
1 x ELOF1-elon...113,40 € -
1 x CCDC109A-c...121,50 € -
1 x C18orf32-c...113,40 € -
1 x C1orf210-c...113,40 € -
1 x Interleuki...494,00 € -
1 x CCDC67-coi...121,50 € -
No products
To be determined Shipping
2 774,47 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 21 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 774,47 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 774,47 €
Data sheet of ZNF444-zinc finger protein 444 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZNF444-zinc finger protein 444 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021282 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZNF444 |
| Origin species: | Human |
| Product name: | ZNF444-zinc finger protein 444 Gene |
| Size: | 2ug |
| Accessions: | BC021282 |
| Gene id: | 55311 |
| Gene description: | zinc finger protein 444 |
| Synonyms: | EZF-2; EZF2; ZSCAN17; zinc finger protein 444; zinc finger and SCAN domain-containing protein 17 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggtggcggtgcccgtgaagcaggaggccgagggcctggcgctggactccccgtggcaccgcttccgccgcttccacctgggcgacgcgccgggcccgcgggaggcgctggggctgctccgcgccctgtgccgggactggctgcggcccgaggtgcacaccaaggagcagatgttggagctgctggtgctggaacagttcctgagcgcgctgcccgccgacacgcaggcctgggtgtgcagccggcagccgcagagcggggaggaggcggtggccctgctggaggagctctgggggccagcagcctcccccgatgggtcgtcagcaacgagggtgcctcaggatgtgacgcagggccctggggccacaggtggaaaggaggacagtgggatgattcccttaggcaccgcccctggggctgaggggccggcgcctggggactcccaggctgtgcgcccctacaagcaggagcccagcagccccccgctggcgcctggcctgcccgccttcctagcggccccgggcaccacgtcctgccccgagtgcggcaaaacgtccctgaaaccagctcacctgctgcgccaccggcagagccactcgggcgagaagccgcacgcctgccctgagtgcgggaaggcctttcggcgcaaggagcacctgcggcgccaccgcgacacgcaccccggcagccccggcagccccgggcccgcgctgcgccctctgcccgcccgtgagaagccccacgcgtgctgcgagtgtggcaagaccttctactggcgcgagcacctggtgcgccaccgcaagacgcactcgggagcgcggccctttgcctgctgggagtgtggcaagggcttcgggcgccgcgagcacgtgctgcgccaccagcgcatccacggccgggcagcggccagcgcgcagggggcggtagctccgggcccggatggtggaggccccttcccgccctggcccttgggttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proline rich 7 (synaptic) - KIAA0644 gene product - TRAF interacting protein - replication initiator 1 |