Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FASLG-Fas ligand (TNF superfamily, member 6) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FASLG-Fas ligand (TNF superfamily, member 6) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017502 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FASLG |
| Origin species: | Human |
| Product name: | FASLG-Fas ligand (TNF superfamily, member 6) Gene |
| Size: | 2ug |
| Accessions: | BC017502 |
| Gene id: | 356 |
| Gene description: | Fas ligand (TNF superfamily, member 6) |
| Synonyms: | ALPS1B; APT1LG1; APTL; CD178; CD95-L; CD95L; TNFSF6; TNLG1A; tumor necrosis factor ligand superfamily member 6; CD95 ligand; Fas ligand (TNF superfamily, member 6); apoptosis (APO-1) antigen ligand 1; apoptosis antigen ligand; fas antigen ligand; mutant tumor necrosis factor family member 6; tumor necrosis factor ligand 1A; Fas ligand |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagcagcccttcaattacccatatccccagatctactgggtggacagcagtgccagctctccctgggcccctccaggcacagttcttccctgtccaacctctgtgcccagaaggcctggtcaaaggaggccaccaccaccaccgccaccgccaccactaccacctccgccgccgccgccaccactgcctccactaccgctgccacccctgaagaagagagggaaccacagcacaggcctgtgtctccttgtgatgtttttcatggttctggttgccttggtaggattgggcctggggatgtttcagctcttccacctacagaaggagctggcagaactccgagagtctaccagccagatgcacacagcatcatctttggagaagcaaataggccaccccagtccaccccctgaaaaaaaggagctgaggaaagtggcccatttaacaggcaagtccaactcaaggtccatgcctctggaatgggaagacacctatggaattgtcctgctttctggagtgaagtataagaagggtggccttgtgatcaatgaaactgggctgtactttgtatattccaaagtatacttccggggtcaatcttgcaacaacctgcccctgagccacaaggtctacatgaggaactctaagtatccccaggatctggtgatgatggaggggaagatgatgagctactgcactactgggcagatgtgggcccgcagcagctacctgggggcagtgttcaatcttaccagtgctgatcatttatatgtcaacgtatctgagctctctctggtcaattttgaggaatctcagacgtttttcggcttatataagctctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - WD repeat and FYVE domain containing 2 - trafficking protein, kinesin binding 1 - CD36 molecule (thrombospondin receptor) - chromosome 16 open reading frame 14 |