Cart 9 Product Products 1 053,97 € (empty)
-
1 x SNX32-sort...121,50 € -
-
1 x C5orf30-ch...113,40 € -
1 x ASS1-argin...121,50 € -
1 x RBMY1A1-RN...121,50 € -
1 x PRRT2-prol...121,50 € -
1 x CBLN4-cere...113,40 € -
1 x TBPL1-TBP-...113,40 € -
1 x GTPBP10-GT...121,50 €
No products
To be determined Shipping
1 053,97 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 053,97 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 053,97 €
View larger 
Data sheet of CDR2-cerebellar degeneration-related protein 2, 62kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CDR2-cerebellar degeneration-related protein 2, 62kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017503 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CDR2 |
| Origin species: | Human |
| Product name: | CDR2-cerebellar degeneration-related protein 2, 62kDa Gene |
| Size: | 2ug |
| Accessions: | BC017503 |
| Gene id: | 1039 |
| Gene description: | cerebellar degeneration-related protein 2, 62kDa |
| Synonyms: | CDR62; cerebellar degeneration-related protein 2; Yo paraneoplastic antigen; cerebellar degeneration-related protein 2, 62kDa; major Yo paraneoplastic antigen; paraneoplastic cerebellar degeneration-associated antigen; cerebellar degeneration related protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaggaggacgagccgtggtacgaccaccaggacctccagcaagatcttcaacttgctgctgagcttgggaagacattactggatcggaacacagagttggaggactctgttcagcagatgtatacaaccaatcaggagcagttacaggaaattgagtatctgacgaagcaagtggaacttctacggcagatgaacgaacaacatgcaaaggtttatgaacaattagacgtcacagcaagggaactggaagaaacaaatcaaaagctagttgctgacagcaaggcctcacagcaaaagattctgagcctgactgaaacgattgaatgcctgcaaaccaacattgatcacctccagagccaagtggaggagctgaagtcatctggccaagggagaaggagcccgggaaagtgtgaccaggagaaaccggcacccagctttgcatgtctgaaggagctgtatgacctccgccaacacttcgtgtatgatcatgtgttcgctgagaagatcacttccttgcaaggtcagccaagccctgatgaagaggaaaatgagcacttgaaaaaaacagtgacaatgttgcaggcccagctgagcctggagcggcagaagcgggtgactatggaggaggaatatgggctcgtgttaaaggagaacagtgaactggagcagcagctgggggccacaggtgcctaccgagcacgggcgctggaactagaggccgaggtggcagagatgcgacagatgttgcagtcagagcatccatttgtgaatggagttgagaagctggtgccagactctctgtatgttcctttcaaagagcccagccagagcctgctggaagagatgttcctgactgtgccggaatcacatagaaagcctctcaagcgcagcagcagtgagacgatcctcagcagcttggcagggagtgacatcgtgaagggccacgaggagacctgcatcaggagggccaaggctgtgaaacagaggggcatctcccttctgcacgaagtggacacgcagtacagcgccctgaaggtgaagtatgaagagttgctgaagaagtgccaagaggaacaggactccctgtcacacaaggctgtgcagacctccagggctgcagccaaggacctgactggagtgaacgcccagtctgagcctgttgccagcggctgggaactggcctctgtcaacccagagcccgtgagttcccctacaacacctccagaatacaaagcgttgtttaaggagatctttagttgcatcaagaaaactaagcaggaaatagatgaacagagaacaaaataccgatcactctcctctcattcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CDK5 regulatory subunit associated protein 3 - erythrocyte membrane protein band 4.9 (dematin) - family with sequence similarity 126, member A - reticulocalbin 2, EF-hand calcium binding domain |