Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
OR7E91P-olfactory receptor, family 7, subfamily E, member 91 pseudogene Gene
PTXBC014374
New product
Data sheet of OR7E91P-olfactory receptor, family 7, subfamily E, member 91 pseudogene Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OR7E91P-olfactory receptor, family 7, subfamily E, member 91 pseudogene Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014374 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OR7E91P |
| Origin species: | Human |
| Product name: | OR7E91P-olfactory receptor, family 7, subfamily E, member 91 pseudogene Gene |
| Size: | 2ug |
| Accessions: | BC014374 |
| Gene id: | 79315 |
| Gene description: | olfactory receptor, family 7, subfamily E, member 91 pseudogene |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgcttcttcctctccaacctgtgctgggctgacatcggtttcacctcggccacggttcccaagatgattgtggacatgcggtcgcatagcggagtcatctcttatgcggactgcctgacacggatgtctttcttggtcctttttgcatgtgtagaagacatgctcctgactgtgatggcctatgactgttttgtagccatctgtcgccctctgcactacccagtcatcgtgaatcctcacctctgtgtcttcttagtttcggtgtccttttccttagcctgttggattcccagctgcgcagttggattgtgttgcaattcaccttcttcaagaatgtggaaatctctaattttgtctgtgacccatctcaacctctcaagcttgcctgttctgacagcatcatcgatagcatgttcatatatttcgatagtactatgtttggttttcttcccatttcagggatccttttgtcttactataaaattgtcccctccattctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - neural precursor cell expressed, developmentally down-regulated 8 - glutamyl-tRNA(Gln) amidotransferase, subunit C homolog (bacterial) - phospholysine phosphohistidine inorganic pyrophosphate phosphatase - RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae) |