Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KLRC1-killer cell lectin-like receptor subfamily C, member 1 Gene
PTXBC012550
New product
Data sheet of KLRC1-killer cell lectin-like receptor subfamily C, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KLRC1-killer cell lectin-like receptor subfamily C, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012550 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KLRC1 |
| Origin species: | Human |
| Product name: | KLRC1-killer cell lectin-like receptor subfamily C, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC012550 |
| Gene id: | 3821 |
| Gene description: | killer cell lectin-like receptor subfamily C, member 1 |
| Synonyms: | CD159A; NKG2; NKG2-A/NKG2-B type II integral membrane protein; C-lectin type II protein; CD159 antigen-like family member A; NK cell receptor A; NKG2-1/B activating NK receptor; NKG2-A/B type II integral membrane protein; NKG2-A/B-activating NK receptor; killer cell lectin-like receptor subfamily C, member 1; natural killer cell lectin; natural killer group protein 2; killer cell lectin like receptor C1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggataaccaaggagtaatctactcagacctgaatctgcccccaaacccaaagaggcagcaacgaaaacctaaaggcaataaaagctccattttagcaactgaacaggaaataacctatgcggaattaaaccttcaaaaagcttctcaggattttcaagggaatgacaaaacctatcactgcaaagatttaccatcagctccagagaagctcattgttgggatcctgggaattatctgtcttatcttaatggcctctgtggtaacgatagttgttattccctcacgtcattgtggccattgtcctgaggagtggattacatattccaacagttgttactacattggtaaggaaagaagaacttgggaagagagtttgctggcctgtacttcgaagaactccagtctgctttctatagataatgaagaagaaatgaaatttctgtccatcatttcaccatcctcatggattggtgtgtttcgtaacagcagtcatcatccatgggtgacaatgaatggtttggctttcaaacatgagataaaagactcagataatgctgaacttaactgtgcagtgctacaagtaaatcgacttaaatcagcccagtgtggatcttcaataatatatcattgtaagcataagctttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - major histocompatibility complex, class II, DM alpha - ATP-binding cassette, sub-family B (MDR/TAP), member 9 - major histocompatibility complex, class II, DO alpha - cleavage and polyadenylation specific factor 1, 160kDa |