No products
Prices are tax excluded
PTXBC011789
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC011789 |
Product type: | DNA & cDNA |
Ncbi symbol: | COPS7A |
Origin species: | Human |
Product name: | COPS7A-COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) Gene |
Size: | 2ug |
Accessions: | BC011789 |
Gene id: | 50813 |
Gene description: | COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) |
Synonyms: | CSN7; CSN7A; SGN7a; COP9 signalosome complex subunit 7a; COP9 complex subunit 7a; COP9 constitutive photomorphogenic homolog subunit 7A; JAB1-containing signalosome subunit 7a; dermal papilla-derived protein 10; COP9 signalosome subunit 7A |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgagtgcggaagtgaaggtgacagggcagaaccaggagcaatttctgctcctagccaagtcggccaagggggcagcgctggccacactcatccatcaggtgctggaggcccctggtgtctacgtgtttggagaactgctggacatgcccaatgttagagagctggctgagagtgactttgcctctaccttccggctgctcacagtgtttgcttatgggacatacgctgactacttagctgaagcccggaatcttcctccactaacagaggctcagaagaataagcttcgacacctctcagttgtcaccctggctgctaaagtaaagtgtatcccatatgcagtgttgctggaggctcttgccctgcgtaatgtgcggcagctggaagaccttgtgattgaggctgtgtatgctgacgtgcttcgtggctccctggaccagcgcaaccagcggctcgaggttgactacagcatcgggcgggacatccagcgccaggacctcagtgccattgcccgaaccctgcaggaatggtgtgtgggctgtgaggtcgtgctgtcaggcattgaggagcaggtgagccgtgccaaccaacacaaggagcagcagctgggcctgaagcagcagattgagagtgaggttgccaaccttaaaaaaaccattaaagttacgacggcagcagcagccgcagccacatctcaggaccctgagcaacacctgactgagctgagggaaccagctcctggcaccaaccagcgccagcccagcaagaaagcctcaaagggcaaggggctccgagggagcgccaagatttggtccaagtcgaattga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast) - UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1 - ELOVL family member 7, elongation of long chain fatty acids (yeast) - M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein) |