Cart 6 Product Products 700,77 € (empty)
-
1 x BMI1-BMI1...121,50 € -
1 x CENPA-cent...113,40 € -
1 x STAMBP-STA...121,50 € -
1 x FAM100A-fa...113,40 € -
-
1 x GPD1L-glyc...121,50 €
No products
To be determined Shipping
700,77 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 700,77 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 700,77 €
Data sheet of FKBP14-FK506 binding protein 14, 22 kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FKBP14-FK506 binding protein 14, 22 kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005206 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FKBP14 |
| Origin species: | Human |
| Product name: | FKBP14-FK506 binding protein 14, 22 kDa Gene |
| Size: | 2ug |
| Accessions: | BC005206 |
| Gene id: | 55033 |
| Gene description: | FK506 binding protein 14, 22 kDa |
| Synonyms: | PPIase FKBP14; peptidyl-prolyl cis-trans isomerase FKBP14; EDSKMH; FKBP22; IPBP12; 22 kDa FK506-binding protein; 22 kDa FKBP; FK506 binding protein 14, 22 kDa; FKBP-22; rotamase; FK506 binding protein 14 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggcttttcttgtggaacgcggtcttgactctgttcgtcacttctttgattggggctttgatccctgaaccagaagtgaaaattgaagttctccagaagccattcatctgccatcgcaagaccaaaggaggggatttgatgttggtccactatgaaggctacttagaaaaggacggctccttatttcactccactcacaaacataacaatggtcagcccatttggtttaccctgggcatcctggaggctctcaaaggttgggaccagggcttgaaaggaatgtgtgtaggagagaagagaaagctcatcattcctcctgctctgggctatggaaaagaaggaaaaggtaaaattcccccagaaagtacactgatatttaatattgatctcctggagattcgaaatggaccaagatcccatgaatcattccaagaaatggatcttaatgatgactggaaactctctaaagatgaggttaaagcatatttaaagaaggagtttgaaaaacatggtgcggtggtgaatgaaagtcatcatgatgctttggtggaggatatttttgataaagaagatgaagacaaagatgggtttatatctgccagagaatttacatataaacacgatgagttatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAB3C, member RAS oncogene family - Kv channel interacting protein 2 - RAB31, member RAS oncogene family - aldolase A, fructose-bisphosphate |