Cart 3 Product Products 337,68 € (empty)
-
1 x IMPACT-Imp...121,50 € -
-
1 x C4orf12-ch...113,40 €
No products
To be determined Shipping
337,68 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 337,68 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 337,68 €
View larger 
Data sheet of DNAJC30-DnaJ (Hsp40) homolog, subfamily C, member 30 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DNAJC30-DnaJ (Hsp40) homolog, subfamily C, member 30 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005056 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DNAJC30 |
| Origin species: | Human |
| Product name: | DNAJC30-DnaJ (Hsp40) homolog, subfamily C, member 30 Gene |
| Size: | 2ug |
| Accessions: | BC005056 |
| Gene id: | 84277 |
| Gene description: | DnaJ (Hsp40) homolog, subfamily C, member 30 |
| Synonyms: | WBSCR18; dnaJ homolog subfamily C member 30; DnaJ (Hsp40) homolog, subfamily C, member 30; Williams Beuren syndrome chromosome region 18; williams-Beuren syndrome chromosomal region 18 protein; DnaJ heat shock protein family (Hsp40) member C30 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagccatgcgctggcgatggtggcagcggctgttaccttggaggttgctgcaggcccgtggctttccacaaaattctgcacccagcctgggcctaagagcgaggacttattcccagggcgactgctcgtattcgcgcacggcgctgtatgatctgctcggcgtcccctccacagccacgcaggcccaaatcaaggcggcttactaccgtcagtgctttctctaccacccggaccgcaactccgggagcgcggaggccgccgagcgcttcacgcgcatctcccaggcctacgtggtgctgggcagtgccaccctccgtcgcaagtatgatcgcggcctactcagcgacgaggacctgcgcggacctggcgtccggccctccaggacgcccgcacccgaccccggctcgccgcgtaccccgccgcccacctctcggacccacgacggttctcgggcctcccccggcgccaaccgcacgatgttcaactttgacgccttctaccaggcccactacggggaacaactggagcgggaacggcgcctgagggcccggcgggaggcccttcgcaaacggcaggagtatcggtccatgaaaggcctccgctgggaggatacccgagacacggctgccattttcctcatcttttcaatcttcatcatcatcggcttttatatttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - defects in morphology 1 homolog (S. cerevisiae) - cell division cycle 16 homolog (S. cerevisiae) - receptor tyrosine kinase-like orphan receptor 1 - erythrocyte membrane protein band 4.1-like 3 |