No products
Prices are tax excluded
PTXBC017101
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC017101 |
Product type: | DNA & cDNA |
Ncbi symbol: | POMZP3 |
Origin species: | Human |
Product name: | POMZP3-POM (POM121 homolog, rat) and ZP3 fusion Gene |
Size: | 2ug |
Accessions: | BC017101 |
Gene id: | 22932 |
Gene description: | POM (POM121 homolog, rat) and ZP3 fusion |
Synonyms: | POM-ZP3; POM121; POM121 and ZP3 fusion protein; POM (POM121 homolog, rat) and ZP3 fusion; POM (POM121 rat homolog) and ZP3 fusion; POM-ZP3 fusion protein; POM121/ZP3 fusion protein; POM121 and ZP3 fusion |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggtgtgtagcccagtgactctgaggatcgcccctcctgacagaagattttcgcgttctgcgataccagagcagataatcagctcaacactgtcctcaccatcaagtaatgccccagacccatgtgcaaaggagactgtactgagtgccctcaaagagaagaagaagaaaaggacagtggaggaagaagaccaaatattccttgatggccaggaaaataaaagaagctgtcttgtcgacggtctcactgatgcctcttctgcattcaaagttcctcgacccgggccagatacactccagttcacagtggatctcttccactttgctaatgactccagaaacatgatatacatcacctgccacctgaaggtcaccctagctgagcaggacccagatgaactcaacaaggcctgttccttcagcaagccttccaacagctggttcccagtggaaggcccggctgacatctgtcaatgctgtaacaaaggtgactgtggcactccaagccattccaggaggcagcctcgtgtcgtgagccagtggtccacgtctgcttcccgtaaccgcaggcatgtgacagaagaagcagatgtcaccgtgggggccactgatcttcctggacaggagtggtga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - DEAD (Asp-Glu-Ala-Asp) box polypeptide 27 - DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 - CCR4-NOT transcription complex, subunit 6 - serine peptidase inhibitor, Kazal type 6 |