Cart 15 Product Products 1 727,52 € (empty)
-
1 x ECHDC1-eno...121,50 € -
1 x IL28B-inte...113,40 € -
1 x CRTC1-CREB...121,50 € -
1 x EBAG9-estr...113,40 € -
1 x SYT14L-syn...113,40 € -
1 x PGC-progas...113,40 € -
1 x IRF3-inter...121,50 € -
-
1 x ITGB3BP-in...113,40 € -
-
-
1 x C20orf30-c...113,40 € -
1 x COX5B-cyto...113,40 € -
1 x TFAP4-tran...121,50 € -
1 x LOC388965-...113,40 €
No products
To be determined Shipping
1 727,52 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 15 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 727,52 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 727,52 €
View larger 
Data sheet of SLC25A44-solute carrier family 25, member 44 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC25A44-solute carrier family 25, member 44 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008843 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC25A44 |
| Origin species: | Human |
| Product name: | SLC25A44-solute carrier family 25, member 44 Gene |
| Size: | 2ug |
| Accessions: | BC008843 |
| Gene id: | 9673 |
| Gene description: | solute carrier family 25, member 44 |
| Synonyms: | solute carrier family 25 member 44 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggacaaacgcaacatccagatcatcgagtgggaacacctggacaagaagaagttctacgtgtttggtgtggcaatgacaatgatgatccgtgtcagtgtctacccattcaccctcatccgcacccggttgcaagttcagaaggggaagagcctctaccatgggaccttcgatgccttcatcaagatcctgcgagcagatggtatcactggcctctaccgagggttcctggtcaataccttcaccctcatctctggccagtgttatgtcaccacttatgagctcacccggaagtttgtagctgactacagccagagtaacacagtcaaatcactggtggctggtggctcagcctcccttgtggcccagagcatcacagtgcccattgatgtagtctcccagcacctgatgatgcaacgcaagggtgagaaaatgggccgctttcaggtgcgggggaacccagagggacaaggggtagttgcctttggccaaaccaaggacatcatcaggcagatcctgcaggctgatggacttcgcggcttctatcgaggctatgtggcttcactgcttacctatatcccaaacagtgctgtctggtggcccttctatcacttctatgcagagcagctctcctacctgtgtcctaaggagtgccctcacattgtctttcaagctgtctcggggcccctggctgcagccactgcctccatcctcaccaatcccatggatgtcatacgaacccgtgtgcaggttgagggcaagaactccatcatcctgaccttcagacagctgatggcagaagaagggccttggggcctcatgaagggcctctcggccagaatcatctcagccacaccttccaccattgtcattgtggtgggctatgagagcctcaagaaactcagcctccgacctgagctggtggactcgagacactggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 9 open reading frame 156 - chromosome 11 open reading frame 63 - chromosome 11 open reading frame 60 - activating transcription factor 6 beta |