Cart 14 Product Products 1 983,59 € (empty)
-
1 x Syndecan-1...534,00 € -
-
-
1 x GGA1-golgi...113,40 € -
-
-
1 x AP1S3-adap...113,40 € -
1 x IFIT2-inte...121,50 € -
1 x APITD1-apo...113,40 € -
1 x APIP-APAF1...113,40 € -
-
-
-
1 x HEXIM2-hex...121,50 €
No products
To be determined Shipping
1 983,59 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 14 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 983,59 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 983,59 €
View larger 
ANP32B-acidic (leucine-rich) nuclear phosphoprotein 32 family, member B Gene
PTXBC013003
New product
Data sheet of ANP32B-acidic (leucine-rich) nuclear phosphoprotein 32 family, member B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ANP32B-acidic (leucine-rich) nuclear phosphoprotein 32 family, member B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013003 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ANP32B |
| Origin species: | Human |
| Product name: | ANP32B-acidic (leucine-rich) nuclear phosphoprotein 32 family, member B Gene |
| Size: | 2ug |
| Accessions: | BC013003 |
| Gene id: | 10541 |
| Gene description: | acidic (leucine-rich) nuclear phosphoprotein 32 family, member B |
| Synonyms: | APRIL; PHAPI2; SSP29; acidic leucine-rich nuclear phosphoprotein 32 family member B; acidic (leucine-rich) nuclear phosphoprotein 32 family, member B; acidic protein rich in leucines; silver-stainable protein SSP29; acidic nuclear phosphoprotein 32 family member B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacatgaagaggaggatccacctggagctgaggaaccggaccccggcagctgttcgagaacttgtcttggacaattgcaaatcaaatgatggaaaaattgagggcttaacagctgaatttgtgaacttagagttcctcagtttaataaatgtaggcttgatctcagtttcaaatctccccaagctgcctaaattgaaaaagcttgaactcagtgaaaatagaatctttggaggtctggacatgttagctgaaaaacttccaaatctcacacatctaaacttaagtggaaataaactgaaagatatcagcaccttggaacctttgaaaaagttagaatgtctgaaaagcctggacctctttaactgtgaggttaccaacctgaatgactaccgagagagtgtcttcaagctcctgccccagcttacctacttggatggctatgaccgagaggaccaggaagcacctgactcagatgccgaggtggatggtgtggatgaagaggaggaggacgaagaaggagaagatgaggaagacgaggacgatgaggatggtgaagaagaggagtttgatgaagaagatgatgaagatgaagatgtagaaggggatgaggacgacgatgaagtcagtgaggaggaagaagaatttggacttgatgaagaagatgaagatgaggatgaggatgaagaggaggaagaaggtgggaaaggtgaaaagaggaagagagaaacagatgatgaaggagaagatgattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - olfactory receptor, family 7, subfamily E, member 91 pseudogene - neural precursor cell expressed, developmentally down-regulated 8 - glutamyl-tRNA(Gln) amidotransferase, subunit C homolog (bacterial) - phospholysine phosphohistidine inorganic pyrophosphate phosphatase |