PTXBC008338
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC008338 |
Product type: | DNA & cDNA |
Ncbi symbol: | APBA3 |
Origin species: | Human |
Product name: | APBA3-amyloid beta (A4) precursor protein-binding, family A, member 3 Gene |
Size: | 2ug |
Accessions: | BC008338 |
Gene id: | 9546 |
Gene description: | amyloid beta (A4) precursor protein-binding, family A, member 3 |
Synonyms: | MGC:15815; X11L2; mint3; amyloid beta A4 precursor protein-binding family A member 3; X11-like 2 protein; adapter protein X11gamma; amyloid beta (A4) precursor protein-binding, family A, member 3 (X11-like 2); mint-3; neuron-specific X11L2 protein; neuronal munc18-1-interacting protein 3; phosphotyrosine-binding/-interacting domain (PTB)-bearing protein; amyloid beta precursor protein binding family A member 3 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcccaggcccgggaggccatggaccgcgtcaaggcccccgatggggagacccagcccatgacggaggtggacctgttcgtctccaccaagaggatcaaggtcttgacagcggactcccaggaggccatgatggaccacgccctgcataccatctcctacacagccgacatcggctgcgtgctggtgctgatggcgcggcggcggctggcacggaggccggcaccccaggaccacggccgccgcctctacaagatgctctgccacgtattctacgcagaggacgcccagctcatcgcccaggccattggccaggccttcgccgccgcctacagccagttcctacgggaaagcggtattgaccccagccaggtgggcgtgcacccgagcccaggcgcccgccacctccataatggggacctggaccacttctccaacagtgacaactgccgggaggtgcacctcgagaagcggcgaggggagggcctgggcgtggccctggtggagtcgggctggggctccctgctgcccacagccgtcatcgccaacctgctgcacggggggcctgctgagcgctcgggggccctcagcatcggggaccgcctgaccgccatcaacgggaccagcctggtggggctgcccctggctgcgtgccaggccgctgtccgcgagacgaagtcgcagacgtcggtgacactcagcatcgtccactgccctcccgtcaccaccgccatcatccaccggccccacgcccgcgagcagctgggcttctgcgtggaggacggcatcatctgcagcctcctccgtggtggcatcgccgagcgtgggggcatccgcgtcggccaccgcatcattgagatcaatgggcagagtgtggtggccacgccacacgcccgcatcatcgagctgctcaccgaggcctatggcgaggtgcatatcaagacgatgccagctgccacatatcgcctccttacaggccaggagcagcccgtgtacctgtga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - translocase of outer mitochondrial membrane 40 homolog (yeast) - interleukin-1 receptor-associated kinase 1 binding protein 1 - Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase - ankyrin repeat, SAM and basic leucine zipper domain containing 1 |