Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KCTD15-potassium channel tetramerisation domain containing 15 Gene
PTXBC009335
New product
Data sheet of KCTD15-potassium channel tetramerisation domain containing 15 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCTD15-potassium channel tetramerisation domain containing 15 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009335 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCTD15 |
| Origin species: | Human |
| Product name: | KCTD15-potassium channel tetramerisation domain containing 15 Gene |
| Size: | 2ug |
| Accessions: | BC009335 |
| Gene id: | 79047 |
| Gene description: | potassium channel tetramerisation domain containing 15 |
| Synonyms: | BTB/POZ domain-containing protein KCTD15; potassium channel tetramerisation domain containing 15; potassium channel tetramerization domain-containing protein 15; potassium channel tetramerization domain containing 15 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctcaccgcaaggagcggccgagcgggtcctcgcttcacacacacggcagcaccggcaccgcggagggaggaaacatgtcccggctgtctctcacccggtcgcctgtgtctcccctggctgcccagggcatccccctgccagcccagctcaccaagtccaatgcacctgtgcacatcgatgtgggcagccacatgtacaccagcagcctggccacgctcaccaagtaccctgactccaggataagccgcctcttcaatggcactgaacccatcgtcctggacagtttgaagcaacattatttcattgaccgggatggggagattttccgctacgtcctgagcttcctgcggacgtccaagctgctgcttccggatgactttaaggacttcagtctgctgtacgaggaggcgcgctactatcagctccagcccatggtgcgcgagctggagcgctggcagcaggagcaggagcagcggcgccgcagccgggcctgtgactgcctggtggtgcgcgtcacgcccgacttgggcgagcggatcgcactcagcggcgagaaggccctcatcgaggaggtcttccccgagaccggagacgtcatgtgcaactccgtcaacgccggctggaaccaggaccccacgcacgtcatccgcttcccgctcaatggctactgccggctcaactcggtacaggatgttctataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - synuclein, alpha (non A4 component of amyloid precursor) - phosphoinositide-3-kinase, regulatory subunit 2 (beta) - six transmembrane epithelial antigen of the prostate 1 - phosphatidylinositol glycan anchor biosynthesis, class F |