Cart 30 Product Products 3 486,78 € (empty)
-
1 x TSSC4-tumo...121,50 € -
1 x ZC3H7A-zin...113,40 € -
1 x AKR7A2-ald...121,50 € -
-
1 x EBAG9-estr...113,40 € -
1 x CHST4-carb...121,50 € -
1 x MYL6-myosi...113,40 € -
1 x MUSTN1-mus...113,40 € -
1 x RASGEF1B-R...121,50 € -
-
1 x MYL2-myosi...113,40 € -
1 x KLK4-kalli...113,40 € -
1 x CD300E-CD3...113,40 € -
1 x CXCL11-che...113,40 € -
1 x ALG12-aspa...121,50 € -
1 x AKR1CL2-al...121,50 € -
1 x PAX6-paire...121,50 € -
1 x C1orf116-c...113,40 € -
1 x C15orf15-c...113,40 € -
1 x LRRC29-leu...113,40 € -
1 x NSUN3-NOL1...121,50 € -
1 x REEP3-rece...113,40 € -
1 x ASTN2-astr...113,40 € -
1 x KLF9-Krupp...113,40 € -
1 x FBLN7-fibu...121,50 € -
1 x NOL3-nucle...113,40 € -
1 x MFSD1-majo...121,50 € -
1 x ZSCAN21-zi...121,50 € -
1 x NHLRC1-NHL...121,50 € -
No products
To be determined Shipping
3 486,78 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 30 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 486,78 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 486,78 €
View larger 
PLEKHB2-pleckstrin homology domain containing, family B (evectins) member 2 Gene
PTXBC013991
New product
Data sheet of PLEKHB2-pleckstrin homology domain containing, family B (evectins) member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PLEKHB2-pleckstrin homology domain containing, family B (evectins) member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013991 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PLEKHB2 |
| Origin species: | Human |
| Product name: | PLEKHB2-pleckstrin homology domain containing, family B (evectins) member 2 Gene |
| Size: | 2ug |
| Accessions: | BC013991 |
| Gene id: | 55041 |
| Gene description: | pleckstrin homology domain containing, family B (evectins) member 2 |
| Synonyms: | EVT2; pleckstrin homology domain-containing family B member 2; PH domain-containing family B member 2; evectin-2; pleckstrin homology domain containing, family B (evectins) member 2; pleckstrin homology domain containing B2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgtttgtgaagagtggctggttgctgcgacagagtactattttgaagcgctggaagaagaactggtttgatctgtggtcggatggtcacctgatctattatgatgaccagactcggcagaatatcgaggataaggtccacatgccaatggactgcatcaacatccgcacggggcaggaatgtcgggatactcagcccccggatggaaagtcaaaagactgcatgctccagattgtttgtcgagatgggaaaacaattagtctttgtgcagaaagcacagatgattgcttggcctggaaatttacactccaagattctaggacaaacacagcgtatgtgggctctgcagtcatgaccgatgagacatccgtggtttcctcacctccaccatacacggcctatgctgcaccggcccctgagcaggcttatggctatgggccatacggtggtgcgtacccgccaggaactcaagttgtctacgctgcgaatgggcaggcgtatgccgtgccctaccagtacccatatgcaggactttatggacagcagcctgctaaccaagtcatcattcgagagcgctatcgagacaacgacagcgacctggcactgggcatgctggcaggagcagccacgggcatggccttagggtctctattttgggtcttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - translocase of outer mitochondrial membrane 40 homolog (yeast)-like - sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3 - sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2 - solute carrier family 25 (mitochondrial carrier, brain), member 14 |