PTXBC007312
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC007312 |
Product type: | DNA & cDNA |
Ncbi symbol: | KIRREL2 |
Origin species: | Human |
Product name: | KIRREL2-kin of IRRE like 2 (Drosophila) Gene |
Size: | 2ug |
Accessions: | BC007312 |
Gene id: | 84063 |
Gene description: | kin of IRRE like 2 (Drosophila) |
Synonyms: | FILTRIN; NEPH3; NLG1; kin of IRRE-like protein 2; kin of irregular chiasm-like protein 2; nephrin-like gene 1; nephrin-like protein 3; kin of IRRE like 2 (Drosophila) |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgctcaggatgcgggtccccgccctcctcgtcctcctcttctgcttcagagggagagcaggcccgtcgccccatttcctgcaacagccagaggacctggtggtgctgctgggcgagggaggtgcccaggccagcctgggccgtagagcctcagcctctttctccgagcaaaagaacctgatgcgaatccctggcagcagcgacggctccagttcacgaggtcctgaagaagaggagacaggcagccgcgaggaccggggccccattgtgcacactgaccacagtgatctggttctggaggaggaagggactctggagaccaaggacccaaccaacggttactacaaggtccgaggagtcagtgtgagcctgagccttggcgaagcccctggaggaggtctcttcctgccaccaccctccccccttgggcccccagggacccctaccttctatgacttcaacccacacctgggcatggtccccccctgcagactttacagagccagggcaggctatctcaccacaccccaccctcgagctttcaccagctacatcaaacccacatcctttgggcccccagatctggcccccgggactccccccttcccatatgctgccttccccacacctagccacccgcgtctccagactcacgtgtga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - RAB32, member RAS oncogene family - Der1-like domain family, member 2 - mercaptopyruvate sulfurtransferase - FK506 binding protein 14, 22 kDa |