Cart 5 Product Products 569,81 € (empty)
-
-
1 x IL28A-inte...113,40 € -
-
1 x ORC6L-orig...113,40 € -
1 x ARMCX3-arm...121,50 €
No products
To be determined Shipping
569,81 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 569,81 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 569,81 €
View larger 
Data sheet of MRPS18A-mitochondrial ribosomal protein S18A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPS18A-mitochondrial ribosomal protein S18A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010364 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPS18A |
| Origin species: | Human |
| Product name: | MRPS18A-mitochondrial ribosomal protein S18A Gene |
| Size: | 2ug |
| Accessions: | BC010364 |
| Gene id: | 55168 |
| Gene description: | mitochondrial ribosomal protein S18A |
| Synonyms: | HumanS18b; MRP-S18-3; MRPS18-3; S18bmt; 28S ribosomal protein S18a, mitochondrial; 28S ribosomal protein S18-3, mitochondrial; MRP-S18-a; S18mt-a; mitochondrial ribosomal protein S18-3; mitochondrial ribosomal protein S18A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggccctcaaggctctggtgtccggctgtgggcggcttctccgtgggctactagcgggcccggcagcgaccagctggtctcggcttccagctcgcgggttcagggaagtggtggagacccaagaagggaagacaactataattgaaggccgtatcacagcgactcccaaggagagtccaaatcctcctaacccctctggccagtgccccatctgccgttggaacctgaagcacaagtataactatgacgatgttctgctgcttagccagttcatccggcctcatggaggcatgctgccccgaaagatcacaggcctatgccaggaagaacaccgcaagatcgaggagtgtgtgaagatggcccaccgagcaggtctattaccaaatcacaggcctcggcttcctgaaggagttgttccgaagagcaaaccccaactcaaccggtacctgacgcgctgggctcctggctccgtcaagcccatctacaaaaaaggcccccgctggaacagggtgcgcatgcccgtggggtcaccccttctgagggacaatgtctgctactcaagaacaccttggaagctgtatcactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 25, member 44 - chromosome 9 open reading frame 156 - chromosome 11 open reading frame 63 - chromosome 11 open reading frame 60 |