Cart 1 Product Products 115,24 € (empty)
No products
To be determined Shipping
115,24 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 115,24 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 115,24 €
View larger 
Data sheet of SNRNP40-small nuclear ribonucleoprotein 40kDa (U5) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SNRNP40-small nuclear ribonucleoprotein 40kDa (U5) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001494 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SNRNP40 |
| Origin species: | Human |
| Product name: | SNRNP40-small nuclear ribonucleoprotein 40kDa (U5) Gene |
| Size: | 2ug |
| Accessions: | BC001494 |
| Gene id: | 9410 |
| Gene description: | small nuclear ribonucleoprotein 40kDa (U5) |
| Synonyms: | 40K; HPRP8BP; PRP8BP; PRPF8BP; SPF38; WDR57; U5 small nuclear ribonucleoprotein 40 kDa protein; 38 kDa-splicing factor; Prp8-binding protein; U5 snRNP 40 kDa protein; U5 snRNP-specific 40 kDa protein (hPrp8-binding); U5-40K; U5-40kD protein; WD repeat domain 57 (U5 snRNP specific); WD repeat-containing protein 57; small nuclear ribonucleoprotein 40kDa (U5); small nuclear ribonucleoprotein, U5 40kDa subunit; small nuclear ribonucleoprotein U5 subunit 40 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatagaacagcagaagcgtaagggcccagagttgccgctggttccagtcaagcggcagcggcatgagttgctgttgggagcggggtctggcccaggagccgggcagcagcaggcgacgccgggagccttgctgcaagcgggacctccaagatgttcctcccttcaagccccaatcatgctgctctctggacatgaaggggaagtctactgctgcaagttccaccccaacggatccaccttagcatctgcaggatttgaccgactgatattactgtggaatgtctatggtgactgtgataactatgccacactgaagggacacagtggagcagtgatggaattgcattacaacacagatggcagtatgcttttctcagcatccacagataaaaccgtggctgtgtgggatagtgaaacaggtgagagggttaaaaggctaaagggacatacttcctttgtgaattcctgttatccagccaggagaggccctcagcttgtctgcactggcagtgacgatggcacagttaagctttgggacatccggaagaaagcagccatccagacatttcagaacacgtaccaggtgttagctgtgaccttcaatgacacaagtgatcagattatttctggtggaatagacaatgatatcaaggtctgggacctgcgccagaacaagctaacctacaccatgagaggccatgcagattcagtgactggcctgagtttaagttctgaaggctcttatcttttgtccaatgcaatggacaatacagttcgtgtctgggatgtccggccatttgcccccaaagagagatgtgtaaagatatttcaaggaaatgtgcacaactttgaaaagaaccttctgagatgttcttggtcacctgatggaagcaaaatagcagctggctcagccgacaggtttgtttatgtgtgggataccacaagcaggagaatattgtataagctgcccggccatgctggctccatcaatgaagtggctttccaccctgatgagcccatcattatctcagcatcgagtgacaagagactgtatatgggagagattcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - major histocompatibility complex, class I, C - similar to hypothetical protein MGC27019 - golgi transport 1 homolog B (S. cerevisiae) - fibroblast growth factor receptor substrate 3 |