PTXBC009497
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC009497 |
Product type: | DNA & cDNA |
Ncbi symbol: | C21orf56 |
Origin species: | Human |
Product name: | C21orf56-chromosome 21 open reading frame 56 Gene |
Size: | 2ug |
Accessions: | BC009497 |
Gene id: | 84221 |
Gene description: | chromosome 21 open reading frame 56 |
Synonyms: | C21orf56; speriolin-like protein; spermatogenesis and centriole-associated protein 1-like protein; spermatogenesis and centriole associated 1-like |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggtccggcctaagaaggtgtgtttctcggagagcagcctgcccaccggggacaggaccaggaggagctactacctcaatgagatccagagcttcgcgggcgccgagaaggacgcgcgcgtggtgggcgagatcgccttccagctggaccgccgcatcctggcctacgtgttcccgggcgtgacgcggctctacggcttcacggtggccaacatccccgagaagatcgagcagacctccaccaagtctctggacggctccgtggacgagaggaagctgcgcgagctgacgcagcgctacctggccctgagcgcgcgcctggagaagctgggctacagccgcgacgtgcacccggcgttcagcgagttcctcatcaacacctacggaatcctgaagcagcggcccgacctgcgcgccaaccccctgcacagcagcccggccgcgctgcgcaagctggtcatcgacgtggtgccccccaagttcctgggcgactcgctgctgctgctcaactgcctgtgcgagctctccaaggaggacggcaagcccctcttcgcctggtga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - mitochondrial ribosomal protein S18A - solute carrier family 25, member 44 - chromosome 9 open reading frame 156 - chromosome 11 open reading frame 63 |