Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of MCL1-myeloid cell leukemia sequence 1 (BCL2-related) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MCL1-myeloid cell leukemia sequence 1 (BCL2-related) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017197 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MCL1 |
| Origin species: | Human |
| Product name: | MCL1-myeloid cell leukemia sequence 1 (BCL2-related) Gene |
| Size: | 2ug |
| Accessions: | BC017197 |
| Gene id: | 4170 |
| Gene description: | myeloid cell leukemia sequence 1 (BCL2-related) |
| Synonyms: | bcl-2-related protein EAT/mcl1; mcl1/EAT; MCL1-ES; BCL2L3; EAT; MCL1L; MCL1S; bcl2-L-3; induced myeloid leukemia cell differentiation protein Mcl-1; bcl-2-like protein 3; myeloid cell leukemia 1; myeloid cell leukemia ES; myeloid cell leukemia sequence 1 (BCL2-related); BCL2 family apoptosis regulator |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcggcgccacccgcccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccggcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccgcccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgccgcttgaggagatggaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcactaccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DnaJ (Hsp40) homolog, subfamily C, member 30 - defects in morphology 1 homolog (S. cerevisiae) - cell division cycle 16 homolog (S. cerevisiae) - receptor tyrosine kinase-like orphan receptor 1 |