Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PRKCDBP-protein kinase C, delta binding protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRKCDBP-protein kinase C, delta binding protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011585 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRKCDBP |
| Origin species: | Human |
| Product name: | PRKCDBP-protein kinase C, delta binding protein Gene |
| Size: | 2ug |
| Accessions: | BC011585 |
| Gene id: | 112464 |
| Gene description: | protein kinase C, delta binding protein |
| Synonyms: | CAVIN3; HSRBC; cavin-3; protein kinase C delta-binding protein; sdr-related gene product that binds to c-kinase; serum deprivation response factor-related gene product that binds to C-kinase; protein kinase C delta binding protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagggagagtgcgttggagccggggcctgtgcccgaggcgccggcggggggtcccgtgcacgccgtgacggtggtgaccctgctggagaagctggcctccatgctggagactctgcgggagcggcagggaggcctggctcgaaggcagggaggcctggcagggtccgtgcgccgcatccagagcggcctgggcgctctgagtcgcagccacgacaccaccagcaacaccttggcgcagctgctggccaaggcggagcgcgtgagctcgcacgccaacgccgcccaagagcgcgcggtgcgccgcgcagcccaggtgcagcggctggaggccaaccacgggctgctggtggcgcgcgggaagctccacgttctgctcttcaaggaggagggtgaagtcccagccagcgctttccagaaggcaccagagcccttgggcccggcggaccagtccgagctgggcccagagcagctggaggccgaagttggagagagctcggacgaggagccggtggagtccagggcccagcggctgcggcgcaccggattgcagaaggtacagagcctccgaagggccctttcgggccggaaaggccctgcagcgccaccgcccaccccggtcaagccgcctcgccttgggcctggccggagcgctgaagcccagccggaagcccagcctgcgctggagcccacgctggagccagagcctccgcaggacaccgaggaagatcccgggagacctggggctgccgaagaagctctgctccaaatggagagtgtagcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NADPH dependent diflavin oxidoreductase 1 - zinc finger and BTB domain containing 38 - POM (POM121 homolog, rat) and ZP3 fusion - DEAD (Asp-Glu-Ala-Asp) box polypeptide 27 |