Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of BIRC7-baculoviral IAP repeat-containing 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BIRC7-baculoviral IAP repeat-containing 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014475 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BIRC7 |
| Origin species: | Human |
| Product name: | BIRC7-baculoviral IAP repeat-containing 7 Gene |
| Size: | 2ug |
| Accessions: | BC014475 |
| Gene id: | 79444 |
| Gene description: | baculoviral IAP repeat-containing 7 |
| Synonyms: | RING-type E3 ubiquitin transferase BIRC7; KIAP; LIVIN; ML-IAP; MLIAP; RNF50; baculoviral IAP repeat-containing protein 7; RING finger protein 50; kidney inhibitor of apoptosis protein; livin inhibitor of apoptosis; melanoma inhibitor of apoptosis protein; baculoviral IAP repeat containing 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggacctaaagacagtgccaagtgcctgcaccgtggaccacagccgagccactgggcagccggtgatggtcccacgcaggagcgctgtggaccccgctctctgggcagccctgtcctaggcctggacacctgcagagcctgggaccacgtggatgggcagatcctgggccagctgcggcccctgacagaggaggaagaggaggagggcgccggggccaccttgtccagggggcctgccttccccggcatgggctctgaggagttgcgtctggcctccttctatgactggccgctgactgctgaggtgccacccgagctgctggctgctgccggcttcttccacacaggccatcaggacaaggtgaggtgcttcttctgctatgggggcctgcagagctggaagcgcggggacgacccctggacggagcatgccaagtggttccccagctgtcagttcctgctccggtcaaaaggaagagactttgtccacagtgtgcaggagactcactcccagctgctgggctcctgggacccgtgggaagaaccggaagacgcagcccctgtggccccctccgtccctgcctctgggtaccctgagctgcccacacccaggagagaggtccagtctgaaagtgcccaggagccaggaggggtcagtccagcccaggcccagagggcgtggtgggttcttgagcccccaggagccagggatgtggaggcgcagctgcggcggctgcaggaggagaggacgtgcaaggtgtgcctggaccgcgccgtgtccatcgtctttgtgccgtgcggccacctggtctgtgctgagtgtgcccccggcctgcagctgtgccccatctgcagagcccccgtccgcagccgcgtgcgcaccttcctgtcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SRY (sex determining region Y)-box 2 - guanosine monophosphate reductase 2 - limb region 1 homolog (mouse)-like - regulator of G-protein signaling 17 |