Cart 1 Product Products 113,40 € (empty)
-
1 x APOBEC3C-a...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
Data sheet of ARMET-arginine-rich, mutated in early stage tumors Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ARMET-arginine-rich, mutated in early stage tumors Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007282 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ARMET |
| Origin species: | Human |
| Product name: | ARMET-arginine-rich, mutated in early stage tumors Gene |
| Size: | 2ug |
| Accessions: | BC007282 |
| Gene id: | 7873 |
| Gene description: | arginine-rich, mutated in early stage tumors |
| Synonyms: | ARMET; ARP; mesencephalic astrocyte-derived neurotrophic factor; arginine-rich, mutated in early stage tumors; mesencephalic astrocyte derived neurotrophic factor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggaggatgtgggccacgcaggggctggcggtggcgctggctctgagcgtgctgccgggcagccgggcgctgcggccgggcgactgcgaagtttgtatttcttatctgggaagattttaccaggacctcaaagacagagatgtcacattctcaccagccactattgaaaacgaacttataaagttctgccgggaagcaagaggcaaagagaatcggttgtgctactatatcggggccacagatgatgcagccaccaaaatcatcaatgaggtatcaaagcctctggcccaccacatccctgtggagaagatctgtgagaagcttaagaagaaggacagccagatatgtgagcttaagtatgacaagcagatcgacctgagcacagtggacctgaagaagctccgagttaaagagctgaagaagattctggatgactggggggagacatgcaaaggctgtgcagaaaagtctgactacatccggaagataaatgaactgatgcctaaatatgcccccaaggcagccagtgcacggaccgatttgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - xeroderma pigmentosum, complementation group A - small nuclear ribonucleoprotein 40kDa (U5) - major histocompatibility complex, class I, C - similar to hypothetical protein MGC27019 |