Cart 2 Product Products 243,00 € (empty)
-
1 x DKFZP564O0...121,50 € -
1 x UQCRC1-ubi...121,50 €
No products
To be determined Shipping
243,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 243,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 243,00 €
View larger 
SLC27A4-solute carrier family 27 (fatty acid transporter), member 4 Gene
PTXBC009959
New product
Data sheet of SLC27A4-solute carrier family 27 (fatty acid transporter), member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC27A4-solute carrier family 27 (fatty acid transporter), member 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009959 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC27A4 |
| Origin species: | Human |
| Product name: | SLC27A4-solute carrier family 27 (fatty acid transporter), member 4 Gene |
| Size: | 2ug |
| Accessions: | BC009959 |
| Gene id: | 10999 |
| Gene description: | solute carrier family 27 (fatty acid transporter), member 4 |
| Synonyms: | ACSVL4; FATP4; IPS; long-chain fatty acid transport protein 4; solute carrier family 27 (fatty acid transporter), member 4; solute carrier family 27 member 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccctcacgctgtctacgctgctgcaaccgggccgcatctggacggggcgccgcgcggcggagccgacgccgggccacaatgctgcttggagcctctctggtgggggtgctgctgttctccaagctggtgctgaaactgccctggacccaggtgggattctccctgttgttcctctacttgggatctggcggctggcgcttcatccgggtcttcatcaagaccatcaggcctaccttactggtgatgtgctggtgatggacgagctgggctacctgtacttccgagaccgcactggggacacgttccgctggaaaggtgagaacgtgtccaccaccgaggtggaaggcacactcagccgcctgctggacatggctgacgtggccgtgtatggtgtcgaggtgccaggaaccgagggccgggccggaatggctgctgtggccagccccactggcaactgtgacctggagcgctttgctcaggtcttggagaaggaactgcccctgtatgcgcgccccatcttcctgcgcctcctgcctgagctgcacaaaacaggaacctacaagttccagaagacagagctacggaaggagggctttgacccggctattgtgaaagacccgctgttctatctagatgcccagaagggccgctacgtcccgctggaccaagaggcctacagccgcatccaggcaggcgaggagaagctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transition protein 1 (during histone to protamine replacement) - glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) - potassium voltage-gated channel, KQT-like subfamily, member 5 - integrin, alpha M (complement component 3 receptor 3 subunit) |