Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RCAN3-RCAN family member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RCAN3-RCAN family member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC035854 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RCAN3 |
| Origin species: | Human |
| Product name: | RCAN3-RCAN family member 3 Gene |
| Size: | 2ug |
| Accessions: | BC035854 |
| Gene id: | 11123 |
| Gene description: | RCAN family member 3 |
| Synonyms: | DSCR1L2; MCIP3; RCN3; hRCN3; calcipressin-3; Down syndrome candidate region 1-like 2; Down syndrome critical region gene 1-like 2; down syndrome candidate region 1-like protein 2; myocyte-enriched calcineurin-interacting protein 3; regulator of calcineurin 3 isoform 1b,2; RCAN family member 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgagggacactatgaaatcttggaatgatagccagtcagatctgtgtagcactgaccaagaagaggaagaagagatgatttttggtgaaaatgaagatgatttggatgagatgatggatttaagtgatctgcctacctcactttttgcttgcagcgtccatgaagcagtgtttgaggcacgagagcagaaggaaagatttgaagcactcttcaccatctatgatgaccaggttacttttcagctgtttaaaagctttagaagagtcagaataaatttcagcaaacctgaagcggcagcaagagcgcgaatagaactccacgaaacagacttcaatgggcagaagctaaagctatattttgcacaggtgcagatgtccggcgaagtgcgggacaagtcctatctcctgccaccccagcctgtcaagcagttcctcatctcccctccagcctctcccccagtggggtggaagcagagcgaagatgcgatgcctgttataaattatgatttactctgtgctgtttccaaattgggaccaggagagaaatatgaacttcacgcgggaacagagtcgacacccagcgtggtggttcatgtctgtgaaagtgaaactgaagaggaagaagagacaaaaaaccccaaacagaaaattgcccagacaaggcgccccgaccctccgaccgcagcgttgaatgagccccagacctttgattgcgcgctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - kinesin light chain 1 - kinesin light chain 4 - bridging integrator 1 - aminomethyltransferase |