Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PRDX6-peroxiredoxin 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRDX6-peroxiredoxin 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC035857 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRDX6 |
| Origin species: | Human |
| Product name: | PRDX6-peroxiredoxin 6 Gene |
| Size: | 2ug |
| Accessions: | BC035857 |
| Gene id: | 9588 |
| Gene description: | peroxiredoxin 6 |
| Synonyms: | 1-Cys; AOP2; HEL-S-128m; NSGPx; PRX; aiPLA2; p29; peroxiredoxin-6; 1-Cys PRX; 1-Cys peroxiredoxin; 24 kDa protein; acidic calcium-independent phospholipase A2; antioxidant protein 2; epididymis secretory sperm binding protein Li 128m; liver 2D page spot 40; non-selenium glutathione peroxidase; red blood cells page spot 12; peroxiredoxin 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccggaggtctgcttctcggggacgtggctcccaactttgaggccaataccaccgtcggccgcatccgtttccacgactttctgggagactcatggggcattctcttctcccaccctcgggactttaccccagtgtgcaccacagagcttggcagagctgcaaagctggcaccagaatttgccaagaggaatgttaagttgattgccctttcaatagacagtgttgaggaccatcttgcctggagcaaggatatcaatgcttacaattgtgaagagcccacagaaaagttaccttttcccatcatcgatgataggaatcgggagcttgccatcctgttgggcatgctggatccagcagagaaggatgaaaagggcatgcctgtgacagctcgtgtggtgtttgtttttggtcctgataagaagctgaagctgtctatcctctacccagctaccactggcaggaactttgatgagattctcagggtagtcatctctctccagctgacagcagaaaaaagggttgccaccccagttgattggaaggatggggatagtgtgatggtccttccaaccatccctgaagaagaagccaaaaaacttttcccgaaaggagtcttcaccaaagagctcccatctggcaagaaatacctccgctacacaccccagccttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protocadherin 8 - forkhead box O3 - aurora kinase B - apolipoprotein E |