HSF2-heat shock transcription factor 2 Gene View larger

HSF2-heat shock transcription factor 2 Gene

PTXBC005329

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HSF2-heat shock transcription factor 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HSF2-heat shock transcription factor 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005329
Product type: DNA & cDNA
Ncbi symbol: HSF2
Origin species: Human
Product name: HSF2-heat shock transcription factor 2 Gene
Size: 2ug
Accessions: BC005329
Gene id: 3298
Gene description: heat shock transcription factor 2
Synonyms: HSF 2; HSTF 2; heat shock factor protein 2; heat shock transcription factor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcagagttcgaacgtgccggctttcctcagcaagctgtggacgcttgtggaggaaacccacactaacgagttcatcacctggagccagaatggccaaagttttctggtcttggatgagcaacgatttgcaaaagaaattcttcccaaatatttcaagcacaataatatggcaagctttgtgaggcaactgaatatgtatggtttccgtaaagtagtacatatcgactctggaattgtaaagcaagaaagagatggtcctgtagaatttcagcatccttacttcaaacaaggacaggatgacttgttggagaacattaaaaggaaggtttcatcttcaaaaccagaagaaaataaaattcgtcaggaagatttaacaaaaattataagtagtgctcagaaggttcagataaaacaggaaactattgagtccaggctttctgaattaaaaagtgagaatgagtccctttggaaggaggtgtcagaattacgagcaaagcatgcacaacagcaacaagttattcgaaagattgtccagtttattgttacattggttcaaaataaccaacttgtgagtttaaaacgtaaaaggcctctacttctaaacactaatggagcccaaaagaagaacctgtttcagcacatagtcaaagaaccaactgataatcatcatcataaagtaattttttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical protein FLJ21438
- SET and MYND domain containing 4
- tuftelin interacting protein 11
- ribonuclease P/MRP 30kDa subunit

Reviews

Buy HSF2-heat shock transcription factor 2 Gene now

Add to cart