PTXBC037223
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC037223 |
Product type: | DNA & cDNA |
Ncbi symbol: | MED19 |
Origin species: | Human |
Product name: | MED19-mediator complex subunit 19 Gene |
Size: | 2ug |
Accessions: | BC037223 |
Gene id: | 219541 |
Gene description: | mediator complex subunit 19 |
Synonyms: | DT2P1G7; LCMR1; MED19AS; mediator of RNA polymerase II transcription subunit 19; lung cancer metastasis-related protein 1; mediator of RNA polymerase II transcription, subunit 19 homolog; mediator complex subunit 19 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggagaatttcacggcactgtttggggctcaggctgacccaccaccgcccccaaccgcactcggcttcggaccaggaaagcctccacccccgccaccgcctcctgcgggcgggggacccggcacggccccgcctcccaccgcggccacggctcctcctggcgcggacaagtcaggagctggctgtggccctttttacctcatgagggaactgccaggtagcacagagctgacaggcagcacgaatctgatcacacactacaacttggaacaagcctataataaattctgtgggaagaaggtgaaggagaagctaagtaacttcctgcctgacctgccagggatgattgatctgcctggttcccatgataacagcagcctccgctctctcattgagaagccccctattctcagtagctctttcaatcctatcacagggaccatgctggccggcttccgcctccacactggcccgttgccggagcagtgtcgtctgatgcatattcagcctcccaagaagaagaataagcacaagcacaaacagagccgtacccaggatcctgtccccccaggtaaacccagttaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - transmembrane protein 139 - transmembrane protein 86A - transmembrane protein 129 - transmembrane protein 175 |