Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TNF-tumor necrosis factor (TNF superfamily, member 2) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNF-tumor necrosis factor (TNF superfamily, member 2) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028148 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNF |
| Origin species: | Human |
| Product name: | TNF-tumor necrosis factor (TNF superfamily, member 2) Gene |
| Size: | 2ug |
| Accessions: | BC028148 |
| Gene id: | 7124 |
| Gene description: | tumor necrosis factor (TNF superfamily, member 2) |
| Synonyms: | TNF-a; TNF, monocyte-derived; TNF, macrophage-derived; DIF; TNFA; TNFSF2; TNLG1F; tumor necrosis factor; APC1 protein; cachectin; tumor necrosis factor ligand 1F; tumor necrosis factor ligand superfamily member 2; tumor necrosis factor-alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcactgaaagcatgatccgggacgtggagctggccgaggaggcgctccccaagaagacaggggggccccagggctccaggcggtgcttgttcctcagcctcttctccttcctgatcgtggcaggcgccaccacgctcttctgcctgctgcactttggagtgatcggcccccagagggaagagttccccagggacctctctctaatcagccctctggcccaggcagtcagatcatcttctcgaaccccgagtgacaagcctgtagcccatgttgtagcaaaccctcaagctgaggggcagctccagtggctgaaccgccgggccaatgccctcctggccaatggcgtggagctgagagataaccagctggtggtgccatcagagggcctgtacctcatctactcccaggtcctcttcaagggccaaggctgcccctccacccatgtgctcctcacccacaccatcagccgcatcgccgtctcctaccagaccaaggtcaacctcctctctgccatcaagagcccctgccagagggagaccccagagggggctgaggccaagccctggtatgagcccatctatctgggaggggtcttccagctggagaagggtgaccgactcagcgctgagatcaatcggcccgactatctcgactttgccgagtctgggcaggtctactttgggatcattgccctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - BCL2/adenovirus E1B 19kDa interacting protein 1 - oxidoreductase NAD-binding domain containing 1 - cerebellar degeneration-related protein 2, 62kDa - CDK5 regulatory subunit associated protein 3 |