PTXBC007235
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC007235 |
Product type: | DNA & cDNA |
Ncbi symbol: | ZNRF1 |
Origin species: | Human |
Product name: | ZNRF1-zinc and ring finger 1 Gene |
Size: | 2ug |
Accessions: | BC007235 |
Gene id: | 84937 |
Gene description: | zinc and ring finger 1 |
Synonyms: | E3 ubiquitin-protein ligase ZNRF1; NIN283; nerve injury gene 283; nerve injury-induced gene 283 protein; zinc and ring finger 1, E3 ubiquitin protein ligase; zinc and ring finger protein 1; zinc/RING finger protein 1; zinc and ring finger 1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggggggcaagcagagcacggcggcccgctcccggggccccttcccgggggtctccaccgatgacagcgccgtgccgccgccgggaggggcgccccatttcgggcactaccggacgggcggcggggccatggggctgcgcagccgctcggtcagctcggtggcaggcatgggcatggaccccagcacggccgggggggtgccctttggcctctacacccccgcctcccggggcaccggcgactccgagagggcgcccggcggcggagggtctgcgtccgactccacctatgcccatggcaatggttaccaggagacgggcggcggtcaccatagagacgggatgctgtacctgggctcccgagcctcgctggcggatgctctacctctgcacatcgcacccaggtggttcagctcgcatagtggtttcaagtgccccatttgctccaagtctgtggcttctgacgagatggaaatgcactttataatgtgtttgagcaaacctcgcctctcctacaacgatgatgtgctgactaaagacgcgggtgagtgtgtgatctgcctggaggagctgctgcagggggacacgatagccaggctgccctgcctgtgcatctatcacaaaagctgcatagactcgtggtttgaagtgaacagatcttgtccggaacaccctgcggactga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - IQ motif containing F1 - kinesin family member 9 - zinc finger protein 57 - GATA binding protein 2 |