Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ZNRF1-zinc and ring finger 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZNRF1-zinc and ring finger 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007235 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZNRF1 |
| Origin species: | Human |
| Product name: | ZNRF1-zinc and ring finger 1 Gene |
| Size: | 2ug |
| Accessions: | BC007235 |
| Gene id: | 84937 |
| Gene description: | zinc and ring finger 1 |
| Synonyms: | E3 ubiquitin-protein ligase ZNRF1; NIN283; nerve injury gene 283; nerve injury-induced gene 283 protein; zinc and ring finger 1, E3 ubiquitin protein ligase; zinc and ring finger protein 1; zinc/RING finger protein 1; zinc and ring finger 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggggcaagcagagcacggcggcccgctcccggggccccttcccgggggtctccaccgatgacagcgccgtgccgccgccgggaggggcgccccatttcgggcactaccggacgggcggcggggccatggggctgcgcagccgctcggtcagctcggtggcaggcatgggcatggaccccagcacggccgggggggtgccctttggcctctacacccccgcctcccggggcaccggcgactccgagagggcgcccggcggcggagggtctgcgtccgactccacctatgcccatggcaatggttaccaggagacgggcggcggtcaccatagagacgggatgctgtacctgggctcccgagcctcgctggcggatgctctacctctgcacatcgcacccaggtggttcagctcgcatagtggtttcaagtgccccatttgctccaagtctgtggcttctgacgagatggaaatgcactttataatgtgtttgagcaaacctcgcctctcctacaacgatgatgtgctgactaaagacgcgggtgagtgtgtgatctgcctggaggagctgctgcagggggacacgatagccaggctgccctgcctgtgcatctatcacaaaagctgcatagactcgtggtttgaagtgaacagatcttgtccggaacaccctgcggactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - IQ motif containing F1 - kinesin family member 9 - zinc finger protein 57 - GATA binding protein 2 |