Cart 3 Product Products 356,40 € (empty)
-
1 x EFNB1-ephr...121,50 € -
1 x RCBTB1-reg...121,50 € -
1 x STAG3L4-st...113,40 €
No products
To be determined Shipping
356,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 356,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 356,40 €
Data sheet of MGC34800-hypothetical protein MGC34800 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MGC34800-hypothetical protein MGC34800 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029861 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MGC34800 |
| Origin species: | Human |
| Product name: | MGC34800-hypothetical protein MGC34800 Gene |
| Size: | 2ug |
| Accessions: | BC029861 |
| Gene id: | 162137 |
| Gene description: | hypothetical protein MGC34800 |
| Synonyms: | putative uncharacterized protein MGC34800 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggggacctgccctgggcgccgccagaggcccaagcgcccagcaccgcaggagctggagacgtcgctgagcaccaggtggcgccggcgcggttcctacagggagcctggaggcaggctgcggggtggctgtgccgggagactggagcggctcctggctccgcgcaggcagggcccccagagacagctcatgcagcagatccgcagccccggggccctcaggcaccgccgcggctgccgccctcgctcagtcccgagcgcgtccaccctggccagccagctgcccccgctgaacctgcgccgggcgctccggctctccgttcgggccccagccaaccccgcgggctcaggctcccagttcctgtcccagcctgcgccggctccagcgcccccggctctccagctgctcttcccgactcctatccttggccgcccccagcgcggaaccgacccgcgaccctaccgccaacatcgcgggtctcgcctctcgcagcctttttggcgtccgcgcctcagcgttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribonuclease P/MRP 25kDa subunit - heat shock transcription factor 2 - hypothetical protein FLJ21438 - SET and MYND domain containing 4 |