Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PGRMC2-progesterone receptor membrane component 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PGRMC2-progesterone receptor membrane component 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016692 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PGRMC2 |
| Origin species: | Human |
| Product name: | PGRMC2-progesterone receptor membrane component 2 Gene |
| Size: | 2ug |
| Accessions: | BC016692 |
| Gene id: | 10424 |
| Gene description: | progesterone receptor membrane component 2 |
| Synonyms: | DG6; PMBP; membrane-associated progesterone receptor component 2; progesterone membrane binding protein; steroid receptor protein DG6; progesterone receptor membrane component 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggctggtgatggggacgtgaagctaggcaccctggggagtggcagcgagagcagcaacgacggcggcagcgagagtccaggcgacgcgggagcggcagcggaagggggaggctgggcggcggcggcgttggcgcttctgacggggggcggggaaatgctgctgaacgtggcgctggtggctctggtgctgctgggggcctaccggctgtgggtgcgctgggggcggcggggtctgggggccggggccggggcgggcgaggagagccccgccacctctctgcctcgcatgaagaagcgggacttcagcttggagcagctgcgccagtacgacggctcccgcaacccgcgcatcctgctcgcggtcaatgggaaagtcttcgacgtgaccaaaggcagcaagttctacggcccggcgggtccatatggaatatttgctggtagggatgcctccagaggactggccacattttgcctagataaagatgcacttagagatgaatatgatgatctctcagatttgaatgcagtacaaatggagagtgttcgagaatgggaaatgcagtttaaagaaaaatatgattatgtaggcagactcctaaaaccaggagaagaaccatcagaatatacagatgaagaagataccaaggatcacaataaacaggattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - junctional sarcoplasmic reticulum protein 1 - zinc finger and SCAN domain containing 20 - cadherin 15, type 1, M-cadherin (myotubule) - filamin A, alpha (actin binding protein 280) |