Cart 2 Product Products 233,54 € (empty)
-
1 x ISG20L2-in...121,50 € -
No products
To be determined Shipping
233,54 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 233,54 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 233,54 €
Data sheet of KCNE1L-KCNE1-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNE1L-KCNE1-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC035330 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNE1L |
| Origin species: | Human |
| Product name: | KCNE1L-KCNE1-like Gene |
| Size: | 2ug |
| Accessions: | BC035330 |
| Gene id: | 23630 |
| Gene description: | KCNE1-like |
| Synonyms: | KCNE1L; potassium voltage-gated channel subfamily E regulatory beta subunit 5; AMME syndrome candidate gene 2 protein; AMMECR2 protein; KCNE1-like; cardiac voltage-gated potassium channel accessory subunit 5; potassium channel subunit beta MiRP4; potassium voltage-gated channel subfamily E member 1-like protein; potassium voltage-gated channel, Isk-related family, member 1-like; potassium voltage-gated channel subfamily E regulatory subunit 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaactgcagcgagagccagcggctgcgaacccttctgagccgcctgttgctcgagctgcaccaccggggtaatgccagcggcttgggcgctggccctcgtcccagcatgggcatgggggtcgtgcctgaccctttcgtgggccgcgaggtgaccagcgccaagggcgacgacgcctatctctacatcctgctcatcatgatcttctacgcctgcttggccggaggcctcatcctggcctacacccgctcccgtaagctcgtcgaggccaaggacgagccgtcccaggcttgcgccgagcacgaatgggccccgggaggcgccctgaccgccgacgccgaggctgccgcgggctcccaggccgagggccgccgccagcttgcctccgaggggctgcctgccctcgcccagggcgctgagcgggtctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - gametogenetin - KIAA0196 - CTP synthase - claudin 10 |