PTXBC017492
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC017492 |
Product type: | DNA & cDNA |
Ncbi symbol: | COG8 |
Origin species: | Human |
Product name: | COG8-component of oligomeric golgi complex 8 Gene |
Size: | 2ug |
Accessions: | BC017492 |
Gene id: | 84342 |
Gene description: | component of oligomeric golgi complex 8 |
Synonyms: | CDG2H; DOR1; conserved oligomeric Golgi complex subunit 8; COG complex subunit 8; conserved oligomeric golgi complex component 8; dependent on RIC1; component of oligomeric golgi complex 8 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgaactcctacatgctcatctcggctccagccatcctgggcaccagtaacatgcctgctgctgtgccagccacccagccggggacgctgcagccacccatggtgctcctagatttcccacccctcgcctgctttctcaacaatattctggttgccttcaatgatctgcgcctctgctgccctgtggccctggcgcaggatgtgactggggccttggaagatgcccttgccaaggtaactaaaataatcctggccttccatcgcgctgaagaggctgccttcagcagcggggagcaagagctctttgtccagttctgcactgtcttcctggaagaccttgttccgtatttaaatcgctgtctccaagtcctttttccaccagctcagatagcacagactttaggcattcctcccactcagctctccaagtacggtaacctagggcatgtgaacatcggcgccattcaggagcccctcgcctttatcctgccaaagagagagacgcttttcaccctggatgaccaggcgctggggcccgagctcacagctccagcaccagagcctcccgccgaggagccacgcctggagcccgcgggcccagcctgcccggagggagggcgagcggagacgcaggccgaaccgcccagcgtggggccctag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - chromosome 1 open reading frame 105 - chromosome 11 open reading frame 57 - chromosome 19 open reading frame 66 - chromosome 21 open reading frame 70 |