Cart 2 Product Products 225,44 € (empty)
-
-
1 x HMGA1-high...113,40 €
No products
To be determined Shipping
225,44 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 225,44 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 225,44 €
View larger 
GCSH-glycine cleavage system protein H (aminomethyl carrier) Gene
PTXBC009065
New product
Data sheet of GCSH-glycine cleavage system protein H (aminomethyl carrier) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GCSH-glycine cleavage system protein H (aminomethyl carrier) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009065 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GCSH |
| Origin species: | Human |
| Product name: | GCSH-glycine cleavage system protein H (aminomethyl carrier) Gene |
| Size: | 2ug |
| Accessions: | BC009065 |
| Gene id: | 2653 |
| Gene description: | glycine cleavage system protein H (aminomethyl carrier) |
| Synonyms: | GCE; NKH; glycine cleavage system H protein, mitochondrial; glycine cleavage system protein H (aminomethyl carrier); lipoic acid-containing protein; mitochondrial glycine cleavage system H-protein; glycine cleavage system protein H |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgctgcgagtggtgcggagcgtgcgggccctgctctgcaccctgcgcgcggtcccgttacccgccgcgccctgcccgccgaggccctggcagctgggggtgggcgccgtccgtacgctgcgcactggacccgctctgctctcggtgcgtaaattcacagagaaacacgaatgggtaacaacagaaaatggcattggaacagtgggaatcagcaattttgcacaggaagcgttgggagatgttgtttattgtagtctccctgaagttgggacaaaattgaacaaacaagactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - complement component 1, q subcomponent binding protein - killer cell lectin-like receptor subfamily C, member 1 - major histocompatibility complex, class II, DM alpha - ATP-binding cassette, sub-family B (MDR/TAP), member 9 |