RAB28-RAB28, member RAS oncogene family Gene View larger

RAB28-RAB28, member RAS oncogene family Gene

PTXBC018067

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB28-RAB28, member RAS oncogene family Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAB28-RAB28, member RAS oncogene family Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018067
Product type: DNA & cDNA
Ncbi symbol: RAB28
Origin species: Human
Product name: RAB28-RAB28, member RAS oncogene family Gene
Size: 2ug
Accessions: BC018067
Gene id: 9364
Gene description: RAB28, member RAS oncogene family
Synonyms: RAB28, member RAS oncogene family; CORD18; ras-related protein Rab-28
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggactctgaggaggagagccaggaccggcaactgaaaatcgtcgtgctgggggacggcgcctccgggaagacctccttaactacgtgttttgctcaagaaacttttgggaaacagtacaaacaaactataggactggatttctttttgagaaggataacattgccaggaaacttgaatgttacccttcaaatttgggatataggagggcagacaataggaggcaaaatgttggataaatatatctatggagcacagttgatttggagcatatgcgaacaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RIB43A domain with coiled-coils 1
- coiled-coil domain containing 21
- TNF receptor-associated protein 1
- abhydrolase domain containing 12

Reviews

Buy RAB28-RAB28, member RAS oncogene family Gene now

Add to cart