Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HDHD1A-haloacid dehalogenase-like hydrolase domain containing 1A Gene
PTXBC012494
New product
Data sheet of HDHD1A-haloacid dehalogenase-like hydrolase domain containing 1A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HDHD1A-haloacid dehalogenase-like hydrolase domain containing 1A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012494 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HDHD1A |
| Origin species: | Human |
| Product name: | HDHD1A-haloacid dehalogenase-like hydrolase domain containing 1A Gene |
| Size: | 2ug |
| Accessions: | BC012494 |
| Gene id: | 8226 |
| Gene description: | haloacid dehalogenase-like hydrolase domain containing 1A |
| Synonyms: | HDHD1A; DXF68S1E; FAM16AX; GS1; HDHD1; pseudouridine-5'-phosphatase; 5'-PsiMPase; family with sequence similarity 16, member A, X-linked; haloacid dehalogenase-like hydrolase domain containing 1; haloacid dehalogenase-like hydrolase domain containing 1A; haloacid dehalogenase-like hydrolase domain-containing protein 1; haloacid dehalogenase-like hydrolase domain-containing protein 1A; pseudouridine-5'-monophosphatase; pseudouridine 5'-phosphatase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacggacttcttctggatactgaacggctgtattcagtggtgtttcaagaaatatgtaatcgctatgacaagaaatacagctgggatgtaaagtccctggttatgggtaagaaggcattagaggcggcacagattataatagacgtcttgcagctcccgatgtccaaagaggagctggtggaagaaagccaaacgaagttaaaggaagtgttccccacggctgcgctcatgccaggggcggagaaactcatcatccacctgcggaaacatggcatcccctttgcactggccaccagctcgaggtccgcgtcgttcgatatgaagacaagccgccacaaggagttcttcagcttgttttcccacattgtgctgggagatgaccccgaagtgcagcatggcaagccagacccagacatcttcctagcttgtgccaagaggttctctccccctcctgctatggagaagtgccttgtctttgaagatgctcccaatggggtggaggcggccctggcagctgggatgcaggtggtcatggttcctgacggaaacttgagccgagatctgacaacaaaggccaccctggtgctgaattccctgcaggacttccagcccgagctgtttggtttgccctcctatgagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 - IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) - ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3 - protein phosphatase 1, regulatory (inhibitor) subunit 11 |