PTXBC003403
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC003403 |
Product type: | DNA & cDNA |
Ncbi symbol: | RAP2C |
Origin species: | Human |
Product name: | RAP2C-RAP2C, member of RAS oncogene family Gene |
Size: | 2ug |
Accessions: | BC003403 |
Gene id: | 57826 |
Gene description: | RAP2C, member of RAS oncogene family |
Synonyms: | RAP2C, member of RAS oncogene family; small GTPase RAP2C; ras-related protein Rap-2c |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgagggaatacaaggtagtggtgttagggagtggaggggttggcaaatctgcccttactgtgcagtttgtcactgggactttcattgagaaatatgaccccaccattgaagatttctaccgcaaagagatcgaagtggactcttccccctccgtgctggaaattctggacaccgcaggaactgagcagtttgcctccatgagagatctctacatcaaaaacggccaaggtttcatcctggtttatagcctggttaatcaacagtcttttcaggatatcaagccaatgagagatcaaattgtcagagtgaagagatatgaaaaagtcccactaatcctagtaggaaataaagtggatctggaaccagaaagagaggttatgtcttcagaaggcagagctctggttcaagaatggggctgtcctttcatggagacatcggcaaaaagtaaatcaatggtggatgaactttttgctgagatcgtcaggcaaatgaactattcatccctgccggagaagcaagatcagtgttgtacaacttgtgtcgtccagtaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - ubiquitin associated protein 2-like - chromosome 4 open reading frame 33 - mitochondrial ribosomal protein L47 - chromosome 1 open reading frame 93 |