Cart 8 Product Products 931,50 € (empty)
-
1 x MYOG-myoge...113,40 € -
1 x HLA-DQA1-m...113,40 € -
1 x HLA-C-majo...121,50 € -
1 x TRIM65-tri...113,40 € -
1 x C12orf60-c...113,40 € -
1 x FOSL2-FOS-...121,50 € -
1 x LY9-lympho...113,40 € -
1 x LTV1-LTV1...121,50 €
No products
To be determined Shipping
931,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 931,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 931,50 €
Data sheet of NMB-neuromedin B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NMB-neuromedin B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008603 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NMB |
| Origin species: | Human |
| Product name: | NMB-neuromedin B Gene |
| Size: | 2ug |
| Accessions: | BC008603 |
| Gene id: | 4828 |
| Gene description: | neuromedin B |
| Synonyms: | neuromedin-B; Neuromedin-B-32; neuromedin-beta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccggcgggcggggggcgctcggatgttcggcagcctcctgctcttcgccctgctcgctgccggcgtcgccccgctcagctgggatctcccggagccccgcagccgagccagcaagatccgagtgcactcgcgaggcaacctctgggccaccggtcacttcatgggcaagaagagtctggagccttccagcccatccccattggggacagctacccacacctccctgagggaccagcgactgcagctgagtcatgatctgctcggaatcctcctgctaaagaaggctctgggcgtgagcctcagccgccccgcaccccaaatccagtacaggaggctgctggtacaaatactgcagaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - reticulon 4 - annexin A8 - CD7 molecule - annexin A5 |